Gene TGIF2LY Variant 1
DNA : 0.95 KbNT_011896
mRNA : 859 bp NM_139214
CDS : 558 bp NP_631960
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  43 bp
gaaactggtgacaacagcagagaaaactctggagagctataaactgcgtgaaatgaagtg
cattggaagttacagaaaatacgcaagaacaatgggagaagaactccaggaagtgtaggg
gaggggcagcgtggagaagaaaggatgtgacgtcactgagataaccagctcggctgttag
CAACTCTGTTAGCAAAGCTGTTTGTCTTTCTCGGAAACAACAG
gtgagaattccccttacagacctgcccatgctttctaaagtggctctcccaaacctacct
ttgtcctaactcagttgtctgtgattctcaatatagtaacgataagcctctttgaatatg
gaggccgctgcagacggcccggctgagacccaaagcccggtggaaaaagacagcccggcg
EXON 2  816 bp
aaaggatgtgacgtcactgagataaccagctcggctgttagcaactctgttagcaaagct
gtttgtctttctcggaaacaacaggtgagaattccccttacagacctgcccatgctttct
aaagtggctctcccaaacctacctttgtcctaactcagttgtctgtgattctcaatatag
TAACGATAAGCCTCTTTGAATATGGAGGCCGCTGCAGACGGCCCGGCTGAGACCCAAAGC
CCGGTGGAAAAAGACAGCCCGGCGAAGACCCAAAGCCCAGCCCAAGACACCTCAATCATG
TCGAGAAATAACGCAGATACAGGCAGAGTTCTTGCCTTACCAGAGCACAAGAAGAAGCGC
AAGGGAAACTTGCCAGCCGAGTCCGTTAAGATCCTCCGCGACTGGATGTATAAGCATCGG
TTTAAGGCCTACCCTTCAGAAGAAGAGAAGCAAATGCTGTCAGAGAAGACCAATTTGTCT
TTGTTGCGGATTTCTAACTGGTTTATCAATGCTCGCAGACGCATTCTCCCGGATATGCTT
CAACAGCGTAGAAACGACCCCATCATTGGCCACAAAACGGGCAAAGATGCCCATGCCACC
CACCTGCAGAGCACCGAGGCGTCTGTGCCGGCCAAGTCAGGGCCAGTGGTCCAGACAATG
TACAAAGCCTGCCCCTGTGGCCCTTGCCAAAGGGCCAGATGTCAAGAGAGAAGCAACCAG
ATCCGGAGTCGGCCCCTAGCCAGAAGCTCACCGGAATAGCCCAGCCAAAGAAAAAGGTCA
AGATTTCTATCACTTCCCCGTCTTCTCCAGAACTTGTGTCTCCAGAGGAGTACGCCGACT
TCAGCAGCTTCCTGCTGCTAGTCGATGCAGCAGTACAAACGGCTGCCGAGCTGGAGCTAG
AGAAGAAGCAAGAGCCTAATCCATGATTGATGATGTTCCAAAAACCCAAGTAGTCAGTCC
CTTGTGTACTGTGGTAAACCTGTTTATGTTCACCCC
aacttatttgtatgcttatcttttatagaggcatctttctttctactggttttatgagta
ccaatcttaattattgggactaaattctgtcagatatttcagtgtttccaggtgaaagac
actaaggtgccatcataatgaacactgcagcaaagatttcttaactctccttcctcctgg