Gene CD99 Variant 1
DNA : 50.12 KbNT_079584
mRNA : 1235 bp NM_002414
CDS : 558 bp NP_002405
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  241 bp
cttcgggtcggcgccgccctggctacggccctgtgggtgggtgagggggcgtgggcagtt
tcctgagaaggggcggggcgtgtaccgtactcccctcggcgctgcctgggccacccccgc
ccgcctaccccctctgtctcctccccgggcccggcgttcccgccccttctgtgcgcgcgt
GGAGGCCGGGGCGGGGCGGGCGCAGCCGGCGCTGAGCTTGCAGGGCCGCTCCCCTCACCC
GCCCCCTTCGAGTCCCCGGGCTTCGCCCCACCCGGCCCGTGGGGGAGTATCTGTCCTGCC
GCCTTCGCCCACGCCCTGCACTCCGGGACCGTCCCTGCGCGCTCTGGGCGCACCATGGCC
CGCGGGGCTGCGCTGGCGCTGCTGCTCTTCGGCCTGCTGGGTGTTCTGGTCGCCGCCCCG
G
gtgagcgagcggagggatccgggttgggggacgcggagggcgcgggccgggactggggat
ccgcttgagatgcggcgttgggggcgccccgcggggacacccggagcctcctccctgccc
ggcaggacgcgctgtgcccacgggggcccaggcccggaggaggcgcccactttctcccca
EXON 2  33 bp
cttttaggcatggaagtgaatatttagaatgagaagagaaatcacgcaccttgtaaattt
ttttaagttgctgttttaaatatcacaaaaagaaaaatcgcatatcttttttatctctat
aatattcaaatttatttttatttttcttgtttctaagttgactctttttttctctcttag
ATGGTGGTTTCGATTTATCCGATGCCCTTCCTG
gtgagtatcaacatcattttttaaaatcccgtcaatattttatgttaacatagtatatac
aggcatatcccagccatttccagctaggttctagaccaccgcaataacaggagtcatagc
aatttttggcttcccagtacatataaatgttatgtttactctcaactgtagtctattaag
EXON 3  48 bp
gtcttctgggctcaagagtcgttgtataaacctcagctcggtgtgggcaggtgagaaaaa
acaatgctaaaaacattctccgactgtttccaagaaaatgaaacatccttaaccacaaaa
gagttgacacttgttttcccagctgcaacttttactaactgaaatatcttatctctttag
ACAATGAAAACAAGAAACCCACTGCAATCCCCAAGAAACCCAGTGCTG
gtgagaagggcttcttcctagtatgcaaagaaaaagagcaaatcattttctcggacagca
ggacgggacttaggcaactagaaagaagacagaagtgatttgagtgctccggctggagtc
tggttaatagttaatactggaattgtgttatgatgttacatttcatgtagtgattccagt
EXON 4  45 bp
agaatagtgatgtaaaaatggtcaggaattcactttttctaatgagatcctggtcaagct
gatattcagaaaagtatttaggaatgtggggccgtggtgtgtttttgatctgttcacgag
gtcattccttcctcgtttctctctggaatttggtattaactgctctttcccctcttttag
GGGATGACTTTGACTTAGGAGATGCTGTTGTTGATGGAGAAAATG
gtgagtattttcctttaatctcttctgctgctgatctgcttattatcacccaattatgat
catttcagagagaattctcccatttaaattataaagggaaccagttttcacagtggaaac
ctagggaataggtgtgtcggtttgttcttgctgttgtcgttgggtttttctttacaacca
EXON 5  69 bp
gaactgtggctgaaagttgatgggaggaaactggcaggagactgtgtgtgtacaggtatc
cccaccaggacaaaggccaaggtccaatttctgttcagggaaccatctgtgtgtaaactg
atgtttcattttctttactgcaaggcacttaaaattgcaactctcatctttcacaaacag
ACGACCCACGACCACCGAACCCACCCAAACCGATGCCAAATCCAAACCCCAACCACCCTA
GTTCCTCCG
gtaagagtctctgaccctgtgggatgtcttcatgttgttcagaattcagcgatatttatg
tcagctgagaggaggtgatttcagatgagtgtgtgcttactgttgactgcctgtgcagtg
taatgcccatgttcatgtaatggaaaatgtacatttcaaaaatatatatttagcttggat
EXON 6  48 bp
agtagctgggattacatgtgcctgtcaccacatccagctaatttttatattcttagtgga
gatggggtttcaccatgttgatgaacaggccggttttcatgagtttttcctttattctaa
gacatgaagacccttggaggagttccaggttgacaggtgatgctgtattttctttcctag
GTAGCTTTTCAGATGCTGACCTTGCGGATGGCGTTTCAGGTGGAGAAG
gtacagttatcttgttttctgtctcttttctctctccatcccatgatgcccacctgctct
gtagaatcactacagggtctaaactgtcagctctctgtgaactcacagtgaaatgttcag
ccatctctgtgggaactccgcctgtttgctgaggcttcaaggatgtgggaagtaaaggct
EXON 7  51 bp
ctctgtagctgtgtaacatgcacccttagagtgtaataggcaggaccccagctctgtagc
tgggtaacatgtacccccgtagagtgtaagaagcaggaccccagcctcttcacggtcctg
gctgtgaatttttccttgaccccaaaccttcccattgcagacgttgtttttgtcttgcag
GAAAAGGAGGCAGTGATGGTGGAGGCAGCCACAGGAAAGAAGGGGAAGAGG
gtaggtgcacctggcttctgtcttcttgtctctcccacgtggtgttgagaaggggaagca
gaatgtctgagagctggcggactgcactggcattggcctcctaaagctactggcaggagg
cacgggtgttctgtgccaagtgctcccaagtgatgtagctgcagaggtcccccagcaaac
EXON 8  114 bp
tttgccttcctgtgtatcattctcggcatgcttcctttgcaaatcggtcagctcaggcgt
ctgagatgttctgaggatcttggtgctctcagactgactgtctctgccagccactgcccc
ctgggatcttctctgcaccgtgcgtgtctcaatcacgatgctgtgtgcttcctcctgcag
CCGACGCCCCAGGCGTGATCCCCGGGATTGTGGGGGCTGTCGTGGTCGCCGTGGCTGGAG
CCATCTCTAGCTTCATTGCTTACCAGAAAAAGAAGCTATGCTTCAAAGAAAATG
gtaagtctcagtccgccggtgcctctccttcatgccttgctgattggaaaactgtgcttt
ctttaaaaggcagaaaccaaactcgggctggcacgaaacaggtgcacgatggctgatggt
tcgtgaaactgctaaaattctggaatcgaaccttctggctttgatttcagggctgttctg
EXON 9  57 bp
cttcacttacatgagtgttagactccatgttcccagtgggtctcggggttcagaactgag
tgctctcatccaagcaataggagcgtcgacctcaggaaagcccaagtgttttgtgtgtat
tttgaggagtgggttatctgttgcactgagcctctctgtgtattttcttcttcttttcag
CAGAACAAGGGGAGGTGGACATGGAGAGCCACCGGAATGCCAACGCAGAGCCAGCTG
gtaagaaggacggggaacgatggcttgcacacgtggccagtgttcccattttatcttctc
catcctctcccatcttgctgtcctgctcacattctcaaatttggttgcatggctttgaat
gtcttcctttatgtctcgttgctttggagggatactttcaaaagacaatgaatgtgtaaa
EXON 10  529 bp
tcattcaatgaaattgattgaattgattgagatttagggttttgctttctcgtgatgagt
tttgggcccatttttcttatgcagaaataaaaccactggctcctgaaagttgtaggaact
gtgtccacgtgagtgctcagggacctgggaatgactttcttttgtctctgtctcccacag
TTCAGCGTACTCTTTTAGAGAAATAGAAGATTGTCGGCAGAAACAGCCCAGGCGTTGGCA
GCAGGGTTAGAACAGCTGCCTGAGGCTCCTCCCTGAAGGACACCTGCCTGAGAGCAGAGA
TGGAGGCCTTCTGTTCACGGCGGATTCTTTGTTTTAATCTTGCGATGTGCTTTGCTTGTT
GCTGGGCGGATGATGTTTACTAACGATGAATTTTACATCCAAAGGGGGATAGGCACTTGG
ACCCCCATTCTCCAAGGCCCGGGGGGGCGGTTTCCCATGGGATGTGAAAGGCTGGCCATT
ATTAAGTCCCTGTAACTCAAATGTCAACCCCACCGAGGCACCCCCCCGTCCCCCAGAATC
TTGGCTGTTTACAAATCACGTGTCCATCGAGCACGTCTGAAACCCCTGGTAGCCCCGACT
TCTTTTTAATTAAAATAAGGTAAGCCCTTCAATTTGTTTCTTCAATATTTCTTTCATTTG
TAGGGATATTTGTTTTTCATATCAGACTAATAAAAAGAAATTAGAAACC
aagtacttttttttttttacttaaatattttgccgtgggtggatgttaaagaaggccgtg
gtaatttacaggatgggttccaagttctcttcttctggggctttaaggcagatttccagc
ctaaatgctagctctttatttccaaaatgtccttgttgggctcttttcctttcccgtgtc