Gene TREX2 Variant 5
DNA : 22.92 KbNT_025965
mRNA : 1315 bp NM_017518
CDS : 1077 bp NP_059988
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  138 bp
cgcttcactgtggtcctgcctctgggtggtgccggggcggggggtgggagcccggggccc
gcgcaggcggagatgtcgcccaatgggaagggtcggtcgggaagggggtgggcgcaggcg
ggtgggcgggaagaacgctggaggttgattggcggtcttgccggccagtgaagccagggc
ATGGGCGGGGCGCGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGGCCGT
GGCGGCGACGACTACTCAGAGGACGAGGGCGACAGCAGCGTGTCCAGGGCGGCTGTGGAG
GTGTTCGGGAAGCTGAAG
gtgctgttggcccagaaagccactccagggcgggggaccggggagggccccgcccgaggc
ccgggagggcttgctgcggaagtccgcggcgccacgcggccaccgtcgccggttccggct
gcgccctgttcccttgcagcagggggtgcttgtggatcattcatctttgccctttggtgt
EXON 2  116 bp
aggcaggagaattgctggaacccaggaggtggaggctgcagtgagccgagatcatgccac
tgcactccatccaggctgggcgacagagtgagactccgtctcaaaaataaataaataaat
aaaatgaaatgatgtacactgggactttcagtgaatgttgctttccttttccttgcttag
GACCTAAACTGCCCCTTCCTCGAGGGTCTGTATATCACAGAGCCAAAGACAATTCAGGAA
CTGCTGTGCAGCCCCTCAGAGTACCGCTTGGAGATCCTAGAGTGGATGTGTACCCG
gtaatgcatcagtttcttcctcttcccacctggggtgtgcatgggcgccagccagcccca
cctggggaagatggggtttgtggttactgtgagtagctgtcttcccagagggctccaccc
cctagcctggaccctcgtgagaacagctgtgtaggtaaggagtactggtgacaggcatga
EXON 3  68 bp
ttctttccctaataattaatggaaatgaaatccacgtgacacagaagtaaccactttaaa
gtgagccgctccgtgccgttgagcacgtgcacaggaattcacttcttccagcgcgtatag
agggcccagggggattctctggctgtctccggcctgaccagctctgctgtttccctgcag
GGTCTGGCCCTCACTGCAGGACAGGTTCAGCTCACTGAAAGGGGTCCCAACAGAGGTGAA
GATCCAAG
gtaggtggaatcttggtccattctgagcttgtccacagcctccttatggagtggtggtgc
atgttccattggaccaacgttttcttttaggtggtgcatgttgtgtggatgttgctagag
ccttcttgaaccccacccttccctaggcatggcaggtgggagaactcctctcgcagggac
EXON 4  62 bp
gcccagagaggggtggggccactcagcaagaggcagcgctggcacctgggtgcctgcctc
ctggcccaccctggtctcctatacccagtctagtctgtgggtgctgggcttcctgggtgt
ctgctgtcccctgctgtctgggcaggtgcctgccatgatgggctctttgtgtttcaacag
AAATGACGAAGCTGGGCCACGAGCTGATGCTGTGTGCGCCAGATGACCAGGAGCTCCTCA
AG
gtaagagggcctctgtctgctctgcagacggcacgcacgctttctgccctgggcagggaa
cctcatggtgctggctgaggtgggaggattttcctcccctagtgcctttgaggttcctca
ggccctggggccggctgggtgcccgggcaggctgcttctctaggcatccctggggccaga
EXON 5  92 bp
gcagggagcacttgctagtccaagacattgctgggcaggcacagggtcgttgatgggcca
ggcccctcctttcccctggctcctggcatgggtggcatgtgggggcaggggcactgggga
cagctggccttggcctggcttagatggagccagtgaatgtctgtggtcttccttgcccag
GGCTGTGCCTGCGCCCAGAAGCAGCTACACTTCATGGACCAGTTGCTCGATACCATCCGG
AGCCTGACCATTGGGTGCTCCAGTTGCTCGAG
gtaaaggtgtggatggcccaggtgggcagtattgacgggcttctcttggtcctagttctg
gagctggtaggggctggggtgtcactccccctctgatgctggctggggtgtgacacccca
cttggggatctggctggccaatcaggggccgggcagcatacgggcaaggggcagctgtgt
EXON 6  159 bp
aggcgggcaaaaatggaggagccagggcagacaggtggggcaggattctgcgcggtgggg
cttgtcctggcctctgtgcctggccccgatgtgcttctggggccttccctgtggggctga
gggcctgctgggcgagtgctctggcctgtgacggtgtggccctgggggctgcctttgcag
CCTGATGGAGCACTTCGAGGACACCAGGGAGAAGAACGAGGCCTTGCTGGGGGAGCTCTT
CTCTAGCCCCCACCTGCAGATGCTCCTGAATCCAGAGTGCGACCCGTGGCCCCTGGACAT
GCAGCCCCTCCTCAACAAGCAGAGTGATGACTGGCAGTG
gtacgtgctcctggaggcctcagtggcagcaccctggcctcctgtcccagccccaggctg
cttggttctgttactgcagacacccctggcagcggtgagttgcaagtgttccctttctct
ccctgcagggccagtgcctctgccaagtccgaggaggaggagaagctggcggagcttgcc
EXON 7  100 bp
ggcccctggacatgcagcccctcctcaacaagcagagtgatgactggcagtggtacgtgc
tcctggaggcctcagtggcagcaccctggcctcctgtcccagccccaggctgcttggttc
tgttactgcagacacccctggcagcggtgagttgcaagtgttccctttctctccctgcag
GGCCAGTGCCTCTGCCAAGTCCGAGGAGGAGGAGAAGCTGGCGGAGCTTGCCAGGCAGCT
GCAGGAGAGTGCTGCCAAGTTGCACGCGCTTAGAACGGAG
gtgagggtgctagctcctgggagggggttgcttggaggcaaggccctgctttgtcacctc
cctcagcacgtgaggcttaggcgaggttgcctgtgcaccgggcctgacatgttctagaat
actgtggtgctcagtccgcggggaggtgagaggtgggtcccgtggctgggggaagggatc
EXON 8  225 bp
gctgaggctgggagccagaaggtcttgctctggcctgagtcgctcggtacagctcccctg
tgtccctgtttctgaaagctttcttcctcgccctgggtgtgcagtgtctgaggtgagggc
cggtggcagcctggctggtgggcagggcagcctcaagggactctgcctctggctttgcag
TACTTTGCACAGCATGAGCAAGGGGCTGCTGCGGGCGCAGCCGACATCAGCACCCTAGAC
CAGAAGCTGCGTCTGGTCACTTCCGACTTCCACCAGCTAATCTTGGCTTTTCTCCAAGTC
TACGACGACGAGCTGGGCGAGTGCTGCCAGCGCCCAGGCCCTGACCTCCACCCGTGCGGC
CCCATCATCCAGGCCACGCACCAGAATCTGACTTCCTACAGCCAA
gtaagggtgcccttcccctcccctctaaccgccccctcccctgttcactcagactgagag
cttatatcctgcttgggctcaggggcctcagcagcccctgacaagggaccacagggcagg
accaggggctgggaggggctgggctgggctccctgctggccagtggcgtggcagggctct
EXON 9  115 bp
attggtgacttccccgctgggagttctgtccctcacccttggctgtctttcaggtgaatg
ccacctgatcagtgtgagtgggggtgggaagcaggagatgccgtcgctacgtgagaccag
cggcatttagtgcctgctcgctccctccctccctccctccctccctccctccctccccag
CTGCTGCAAGTGGTCATGGCAGTTGCTGACACCTCTGCGAAGGCCGTGGAGACCGTGAAG
AAGCAGCAAGGCGAGCAGATCTGCTGGGGTGGCAGCAGCTCCGTCATGAGTCTAG
gtacgtggctgcccacctggccctctgcctggggctgccccacgcacaggcttccttttc
tgtgctccactagccctggaggagcatttggggaccggccccttcttttgtttttcattt
tctaatgcatgttttccttcacttgaaaaaatgctttcagcggattatcaaatgaaaacg
EXON 10  240 bp
gcatgtgtctgtatagcagcatgatttatagtcctttgggtatatacccagtaatgggat
ggctgggtcaaatggtatttctagttctagatccctgaggaatcgccacactgacttcca
caatggtggaactagtttacactcccaccatccttttggtttcttttctttcctctgcag
CTACCAAGATGAATGAACTAATGGAGAAATAGAAAGTCTTCAGTGATGGCCTACGCCAAA
GCACAGGATGGGGCGGGCAGGAAGCCCTCTCCCAAGATCGAGTTGGCCGAGGATGGATGA
TTGTGGCAGCAGAAGCCGTTGCAGCCCCACGTTGTGCTCTAGGCAGGGACCTTTGGCCCC
TTTGGGGAGGGAGAGACAGACGGGCGGTTTGACTTGGACACAAAGAAAGCCTTGGTTTCT

aagcagttgcctccagcctgctttctgcttcctcagctctatgtctctctccttcccctt
gtcctgagctgctcaggtggcccaggtctgggcaggctggcggcggccctcctgtcatct
tggcgggcctgggctgcgtcctcttcctgtggctccactcctccctgctgctgccagcca