Gene TREX2 Variant 3
DNA : 25.87 KbNT_025965
mRNA : 2116 bp NM_080699
CDS : 711 bp NP_542430
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  138 bp
cgcttcactgtggtcctgcctctgggtggtgccggggcggggggtgggagcccggggccc
gcgcaggcggagatgtcgcccaatgggaagggtcggtcgggaagggggtgggcgcaggcg
ggtgggcgggaagaacgctggaggttgattggcggtcttgccggccagtgaagccagggc
ATGGGCGGGGCGCGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGGCCGT
GGCGGCGACGACTACTCAGAGGACGAGGGCGACAGCAGCGTGTCCAGGGCGGCTGTGGAG
GTGTTCGGGAAGCTGAAG
gtgctgttggcccagaaagccactccagggcgggggaccggggagggccccgcccgaggc
ccgggagggcttgctgcggaagtccgcggcgccacgcggccaccgtcgccggttccggct
gcgccctgttcccttgcagcagggggtgcttgtggatcattcatctttgccctttggtgt
EXON 2  116 bp
aggcaggagaattgctggaacccaggaggtggaggctgcagtgagccgagatcatgccac
tgcactccatccaggctgggcgacagagtgagactccgtctcaaaaataaataaataaat
aaaatgaaatgatgtacactgggactttcagtgaatgttgctttccttttccttgcttag
GACCTAAACTGCCCCTTCCTCGAGGGTCTGTATATCACAGAGCCAAAGACAATTCAGGAA
CTGCTGTGCAGCCCCTCAGAGTACCGCTTGGAGATCCTAGAGTGGATGTGTACCCG
gtaatgcatcagtttcttcctcttcccacctggggtgtgcatgggcgccagccagcccca
cctggggaagatggggtttgtggttactgtgagtagctgtcttcccagagggctccaccc
cctagcctggaccctcgtgagaacagctgtgtaggtaaggagtactggtgacaggcatga
EXON 3  68 bp
ttctttccctaataattaatggaaatgaaatccacgtgacacagaagtaaccactttaaa
gtgagccgctccgtgccgttgagcacgtgcacaggaattcacttcttccagcgcgtatag
agggcccagggggattctctggctgtctccggcctgaccagctctgctgtttccctgcag
GGTCTGGCCCTCACTGCAGGACAGGTTCAGCTCACTGAAAGGGGTCCCAACAGAGGTGAA
GATCCAAG
gtaggtggaatcttggtccattctgagcttgtccacagcctccttatggagtggtggtgc
atgttccattggaccaacgttttcttttaggtggtgcatgttgtgtggatgttgctagag
ccttcttgaaccccacccttccctaggcatggcaggtgggagaactcctctcgcagggac
EXON 4  62 bp
gcccagagaggggtggggccactcagcaagaggcagcgctggcacctgggtgcctgcctc
ctggcccaccctggtctcctatacccagtctagtctgtgggtgctgggcttcctgggtgt
ctgctgtcccctgctgtctgggcaggtgcctgccatgatgggctctttgtgtttcaacag
AAATGACGAAGCTGGGCCACGAGCTGATGCTGTGTGCGCCAGATGACCAGGAGCTCCTCA
AG
gtaagagggcctctgtctgctctgcagacggcacgcacgctttctgccctgggcagggaa
cctcatggtgctggctgaggtgggaggattttcctcccctagtgcctttgaggttcctca
ggccctggggccggctgggtgcccgggcaggctgcttctctaggcatccctggggccaga
EXON 5  92 bp
gcagggagcacttgctagtccaagacattgctgggcaggcacagggtcgttgatgggcca
ggcccctcctttcccctggctcctggcatgggtggcatgtgggggcaggggcactgggga
cagctggccttggcctggcttagatggagccagtgaatgtctgtggtcttccttgcccag
GGCTGTGCCTGCGCCCAGAAGCAGCTACACTTCATGGACCAGTTGCTCGATACCATCCGG
AGCCTGACCATTGGGTGCTCCAGTTGCTCGAG
gtaaaggtgtggatggcccaggtgggcagtattgacgggcttctcttggtcctagttctg
gagctggtaggggctggggtgtcactccccctctgatgctggctggggtgtgacacccca
cttggggatctggctggccaatcaggggccgggcagcatacgggcaaggggcagctgtgt
EXON 6  159 bp
aggcgggcaaaaatggaggagccagggcagacaggtggggcaggattctgcgcggtgggg
cttgtcctggcctctgtgcctggccccgatgtgcttctggggccttccctgtggggctga
gggcctgctgggcgagtgctctggcctgtgacggtgtggccctgggggctgcctttgcag
CCTGATGGAGCACTTCGAGGACACCAGGGAGAAGAACGAGGCCTTGCTGGGGGAGCTCTT
CTCTAGCCCCCACCTGCAGATGCTCCTGAATCCAGAGTGCGACCCGTGGCCCCTGGACAT
GCAGCCCCTCCTCAACAAGCAGAGTGATGACTGGCAGTG
gtacgtgctcctggaggcctcagtggcagcaccctggcctcctgtcccagccccaggctg
cttggttctgttactgcagacacccctggcagcggtgagttgcaagtgttccctttctct
ccctgcagggccagtgcctctgccaagtccgaggaggaggagaagctggcggagcttgcc
EXON 7  100 bp
ggcccctggacatgcagcccctcctcaacaagcagagtgatgactggcagtggtacgtgc
tcctggaggcctcagtggcagcaccctggcctcctgtcccagccccaggctgcttggttc
tgttactgcagacacccctggcagcggtgagttgcaagtgttccctttctctccctgcag
GGCCAGTGCCTCTGCCAAGTCCGAGGAGGAGGAGAAGCTGGCGGAGCTTGCCAGGCAGCT
GCAGGAGAGTGCTGCCAAGTTGCACGCGCTTAGAACGGAG
gtgagggtgctagctcctgggagggggttgcttggaggcaaggccctgctttgtcacctc
cctcagcacgtgaggcttaggcgaggttgcctgtgcaccgggcctgacatgttctagaat
actgtggtgctcagtccgcggggaggtgagaggtgggtcccgtggctgggggaagggatc
EXON 8  225 bp
gctgaggctgggagccagaaggtcttgctctggcctgagtcgctcggtacagctcccctg
tgtccctgtttctgaaagctttcttcctcgccctgggtgtgcagtgtctgaggtgagggc
cggtggcagcctggctggtgggcagggcagcctcaagggactctgcctctggctttgcag
TACTTTGCACAGCATGAGCAAGGGGCTGCTGCGGGCGCAGCCGACATCAGCACCCTAGAC
CAGAAGCTGCGTCTGGTCACTTCCGACTTCCACCAGCTAATCTTGGCTTTTCTCCAAGTC
TACGACGACGAGCTGGGCGAGTGCTGCCAGCGCCCAGGCCCTGACCTCCACCCGTGCGGC
CCCATCATCCAGGCCACGCACCAGAATCTGACTTCCTACAGCCAA
gtaagggtgcccttcccctcccctctaaccgccccctcccctgttcactcagactgagag
cttatatcctgcttgggctcaggggcctcagcagcccctgacaagggaccacagggcagg
accaggggctgggaggggctgggctgggctccctgctggccagtggcgtggcagggctct
EXON 9  115 bp
attggtgacttccccgctgggagttctgtccctcacccttggctgtctttcaggtgaatg
ccacctgatcagtgtgagtgggggtgggaagcaggagatgccgtcgctacgtgagaccag
cggcatttagtgcctgctcgctccctccctccctccctccctccctccctccctccccag
CTGCTGCAAGTGGTCATGGCAGTTGCTGACACCTCTGCGAAGGCCGTGGAGACCGTGAAG
AAGCAGCAAGGCGAGCAGATCTGCTGGGGTGGCAGCAGCTCCGTCATGAGTCTAG
gtacgtggctgcccacctggccctctgcctggggctgccccacgcacaggcttccttttc
tgtgctccactagccctggaggagcatttggggaccggccccttcttttgtttttcattt
tctaatgcatgttttccttcacttgaaaaaatgctttcagcggattatcaaatgaaaacg
EXON 10  162 bp
gcatgtgtctgtatagcagcatgatttatagtcctttgggtatatacccagtaatgggat
ggctgggtcaaatggtatttctagttctagatccctgaggaatcgccacactgacttcca
caatggtggaactagtttacactcccaccatccttttggtttcttttctttcctctgcag
CTACCAAGATGAATGAACTAATGGAGAAATAGAAAGTCTTCAGTGATGGCCTACGCCAAA
GCACAGGATGGGGCGGGCAGGAAGCCCTCTCCCAAGATCGAGTTGGCCGAGGATGGATGA
TTGTGGCAGCAGAAGCCGTTGCAGCCCCACGTTGTGCTCTAG
gcagggacctttggcccctttggggagggagagacagacgggcggtttgacttggacaca
aagaaagccttggtttctaagcagttgcctccagcctgctttctgcttcctcagctctat
gtctctctccttccccttgtcctgagctgctcaggtggcccaggtctgggcaggctggcg
EXON 11  103 bp
tggaggttactgccttccgcaccactctggcttcctccccgtgcctgtgaagagctcggg
gcctgcttcctaatttgtaaacacggggcgtgtgtctcagtggctgtgagctagcgaggg
ggtggcgagcgagccggctgcgcaggtcctgaggccccaggcctcattgttggccaacag
GCAGCTGGGGGCGGGCTGCGGCCGCTGATTAAAGGCCGCCTAGAGCAGCCTGTGTGGCGA
CAGGTGCCCAGAAGCCCAGGAAGCCGGTCAGTGCCCGCCCCAG
gtaagctggtgtggtggggttggcaaggacagtctccccgggagcctgggggcaagcagg
cagaggccagctcgggaccagcacctgtgtgccagggacaagggtggggaggtcgagccc
agcgggagctgggtgcactgcatgggctctttcgggtggctgcttgcctgcttcccggca
EXON 12  776 bp
gagcgctctgaggcctgccttttctgttcagtaggtgacaggagtggggctgacgctccc
agagccaaaggtcacaggtgctgtggtcgggggtggcaggaagtgagccccagaagggtc
agagctttggctagggggaggatggtacacagcagggcccgggcgaacccctctctccag
TCCTCAGGGTTTGTGCCTCTCGCTCGGACAGTTTGAGGACTTGCTATCCCCGTGGGAACA
TCACCATGTCCGAGGCACCCCGGGCCGAGACCTTTGTCTTCCTGGACCTGGAAGCCACTG
GGCTCCCCAGTGTGGAGCCCGAGATTGCCGAGCTGTCCCTCTTTGCTGTCCACCGCTCCT
CCCTGGAGAACCCGGAGCACGACGAGTCTGGTGCCCTAGTATTGCCCCGGGTCCTGGACA
AGCTCACGCTGTGCATGTGCCCGGAGCGCCCCTTCACTGCCAAGGCCAGCGAGATCACCG
GCCTGAGCAGTGAGGGCCTGGCGCGATGCCGGAAGGCTGGCTTTGATGGCGCCGTGGTGC
GGACGCTGCAGGCCTTCCTGAGCCGCCAGGCAGGGCCCATCTGCCTTGTGGCCCACAATG
GCTTTGATTATGATTTCCCCCTGCTGTGTGCCGAGCTGCGGCGCCTGGGTGCCCGCCTGC
CCCGGGACACTGTCTGCCTGGACACGCTGCCGGCCCTGCGGGGCCTGGACCGCGCCCACA
GCCACGGCACCCGGGCCCGGGGCCGCCAGGGTTACAGCCTCGGCAGCCTCTTCCACCGCT
ACTTCCGGGCAGAGCCAAGCGCAGCCCACTCAGCCGAGGGCGACGTGCACACCCTGCTCC
TGATCTTCCTGCACCGCGCCGCAGAGCTGCTCGCCTGGGCCGATGAGCAGGCCCGTGGGT
GGGCCCACATCGAGCCCATGTACTTGCCGCCTGATGACCCCAGCCTGGAGGCCTGA
gcaccagggccacctcctgtgccatggacagtgccagcctccaccgttcagctggcctct
accacccccggctcctcctatctgggcagcctcaggtccgtgcacctgccaggccttccc
tggctgcctgaccagccatacggccctggattcctctccaggccccgcttccagggccgt