Gene TFE3 Variant 1
DNA : 14.75 KbNT_011568
mRNA : 3393 bp NM_006521
CDS : 1728 bp NP_006512
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  354 bp
gccgaatcgcgtttttcctccgcgtcggaggcgtcgcttagggtgggccctcgaatcgcc
gttcagcgattggccgcctcgctaatgggtcgtggccagacgggccatccatccccagtg
cggtcacttcctgtggagtttccccatccctgggaggagggaggagggggaagaagacga
GGGGGAGGAGGGCGGTCGTCCGGGGTTAGGTTGAGGGGGGGCGTCGGTCCGTTCTGGGCG
GGGGATGACTCACAGCCCATCCCATCTCCCAGACGCCGCCCGCCCGCGCAGTGCTAGCTC
CATGGCTTAGCGGAGGAGGCGGCAGTGGCGAGCTGGGGGGAGGGGGGACTCTTATTTTGT
TAGGGGGACCGGGCCGAGGCCCGACCGGCCTGGCAGGGCTCGCCCGGGGCCGGGCGTCAT
GTCTCATGCGGCCGAACCAGCTCGGGATGGCGTAGAGGCCAGCGCGGAGGGCCCTCGAGC
CGTGTTCGTGCTGTTGGAGGAGCGCAGGCCGGCCGACTCGGCTCAGCTGCTCAG
gtgcggggccgcctggggctgggagtgccgactggggctcccaggggcctgatctcgggg
gcagcgggggccccggactgggattggaggccctcggcctagccttggaggacgtcgggg
cgcccgtcttgggggggcacctaaggaatccggcagtggcctgcttggattgtggcttta
EXON 2  114 bp
gatgggggaaggaggtgggaattcatggtggtgtggtacccagcaaggtggccaaatatg
aggggcttgtaccctcctcttcgttctcccccgctctctgtctctttctctgtctcaggg
gagggctggggaataaggtccttcattcaatcactgaccaccactccacctccccctcag
CCTGAACTCTTTGCTTCCGGAATCCGGGATTGTTGCTGACATAGAATTAGAAAACGTCCT
TGATCCTGACAGCTTCTACGAGCTCAAAAGCCAACCCTTACCCCTTCGCTCAAG
gtatgtatgacttgtctatctgattcccctcccaattcctcagccctcctctcccctctt
gatgggcagaggccctcagtaccagcccaacccattctttcaccagcctgcgttttctag
tggtggtaaaattagggaccagaaagagcatgtcacacaggaaagtaggtggccaagcta
EXON 3  304 bp
ctgtgacccctgagagccatcaccaagcctggttcctgtgtctctgcttctacattgtgg
cctcggaaggcagagaacaggcctggttcctgtgtctgctccgtcacgctaagacccttt
aggcttgggatgagacttttagcttacctaaaatatggccccatatttcccattccacag
CCTCCCAATATCACTGCAGGCCACACCAGCCACCCCAGCTACACTCTCTGCATCGTCTTC
TGCAGGGGGCTCCAGGACCCCTGCCATGTCGTCATCTTCTTCATCGAGGGTCTTGCTGCG
GCAGCAGCTAATGCGGGCCCAGGCGCAGGAGCAGGAGAGGCGTGAGCGTCGGGAACAGGC
CGCCGCGGCTCCCTTCCCCAGTCCTGCACCTGCCTCTCCTGCCATCTCTGTGGTTGGCGT
CTCTGCTGGGGGCCACACATTGAGCCGTCCACCCCCTGCTCAGGTGCCCAGGGAGGTGCT
CAAG
gtaaggtgagatccagaggccctgggagggggctcctggtgactgaggagtgatcctagg
agctagggatggcctcgatgcactggtgatttgggggcaaggtcttaggggctctaagga
aggtccctggtactgtttaaattatctgtgttcatgtctcatgtgttttgggtttctgag
EXON 4  246 bp
gtttgggtcctgggggagactcgctaatatttttggggtgttctcagattctgggcccag
cttgtctgcgtgagtctaggcaccaatgagttaggagggtcaggctggggctcagaattc
acccctttgagtcctgttctgccttgtcccctctctttccttgtctaccttatttcacag
GTGCAGACCCATCTGGAGAACCCAACGCGCTACCACCTGCAGCAGGCGCGCCGGCAGCAG
GTGAAACAGTACCTGTCCACCACACTCGGGCCCAAGCTGGCTTCCCAGGCCCTCACCCCA
CCGCCGGGGCCCGCAAGTGCCCAGCCACTGCCTGCCCCTGAGGCTGCCCACACTACCGGC
CCCACAGGCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAG
AAGGAG
gtaagaggctacagccaaacctcctcccacattcccctcccaaattcttctaaacctgta
taatatttacttcttcccctagattgatgatgtcattgatgagatcatcagcctggagtc
cagttacaatgatgaaatgctcagctatctgcccggaggcaccacaggactgcagctccc
EXON 5  105 bp
tgcctgcccctgaggctgcccacactaccggccccacaggcagtgcgcccaacagcccca
tggcgctgctcaccatcgggtccagctcagagaaggaggtaagaggctacagccaaacct
cctcccacattcccctcccaaattcttctaaacctgtataatatttacttcttcccctag
ATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTC
AGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACG
gtgaggccctgagatgggaggttggtctgaaaattagggcatttctgtatcaccaagacc
atactcagtctggctgtgtgtataggagacccttgccttgattgtgctaagatagagagg
gaggccttatgacgagaacagggtatgtcaacaatgcctttggaccttgttggactgtgt
EXON 6  118 bp
tggtcgccatgtgaatttgccttgaaggagaagcaagggttctggtgctgagtcagccag
tccttgcattagagggtgccccatctttgggatatgtggaagctcaggaacctggttctg
aggaggagccaagcctgggtttgttcccaactggtggttctctgccctctctgcccccag
CTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCC
ATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTG
gtaggtgatagggtcttggccccatggccctacactttaccccaggtgagccctgtgcct
accaggtctagagatgggcctgattctgaggggaatggtttggacatatggaaatggagg
ctgtttgtcccctttccccctatggcttgtggtcttgctttcaccccacttcagttcctc
EXON 7  57 bp
cagttcctctcgtcttggatttaacaaccagcctatcaccatggcttaaaatagtaaaaa
gaaggcactttttaaaaaaggcatttcccctgcttttggctaccaaaccctaccttagta
tctgcatgtgtttcttgccttcctgtgctcagaggccctgatcactccactcttttccag
AGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAA
gtaagccagagagcgtgtgcattgcccgggtgctgtgcaggcctgcctcaccccgagtcc
tggccccccatggggaactccttccctgcaacagcctcccaactccctactttctgtctc
ttccatttttggctaattgacaactctttctcccactctttcttcctctcctcccctctc
EXON 8  76 bp
ccagagagcgtgtgcattgcccgggtgctgtgcaggcctgcctcaccccgagtcctggcc
ccccatggggaactccttccctgcaacagcctcccaactccctactttctgtctcttcca
tttttggctaattgacaactctttctcccactctttcttcctctcctcccctctccaaag
TTGAGCGTCGCAGGCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCC
CTAAGTCCAGTGACCC
gtgagtctgggctgggaccctcaggccagcgggaggtggggcaggcgtcccatgctacta
aaattgtgccttggtgggctcaccaggcagtctcggcccaggcatttctcctctgtctgg
ttctttctcagcctgagcagggttgcagaccctcactatgtcagcacctaaaattttagg
EXON 9  148 bp
ggcaccattgtaagattccaggcgggaagttttcctctggatactccatacctttgaaag
accccagcctcaagttctaagcatgtggtgggaggctcccacctggtgcaatccccgcct
cagctcctgagaaactcctcatgtggcatttcctgcttgcctcccacttgggccccacag
GGAGATGCGCTGGAACAAGGGCACCATCCTGAAGGCCTCTGTGGATTATATCCGCAAGCT
GCAGAAGGAGCAGCAGCGCTCCAAAGACCTGGAGAGCCGGCAGCGATCCCTGGAGCAGGC
CAACCGCAGCCTGCAGCTCCGAATTCAG
gtttgaaaagaggagatggtggtgggggaagagggggagagcttcctgcaggtggaggca
gagagagagcaggccagggtttcccttcctggcatacttgggggatccctgggcttccca
gatcacacgatgatgatagtgataatgataaataataatcataatattaacaaggataat
EXON 10  1871 bp
tacagtttgcgactctgaagcttcagagatgttaagcaccttgcctaaagttttggaact
agtgagtagcagaagctgaattccaacccagggaacctacccttttcaacctttatactc
ctctgcctctgagggactctgaaccctacttatcctgcacccaacccctattttttacag
GAACTAGAACTGCAGGCCCAGATCCATGGCCTGCCAGTACCTCCCACTCCAGGGCTGCTT
TCCTTGGCCACGACTTCGGCTTCTGACAGCCTCAAGCCAGAGCAGCTGGACATTGAGGAG
GAGGGCAGGCCAGGCGCAGCAACGTTCCATGTAGGGGGGGGACCTGCCCAGAATGCTCCC
CATCAGCAGCCCCCTGCACCGCCCTCAGATGCCCTTCTGGACCTGCACTTTCCCAGCGAC
CACCTGGGGGACCTGGGAGACCCCTTCCACCTGGGGCTGGAGGACATTCTGATGGAGGAG
GAGGAGGGGGTGGTGGGAGGACTGTCGGGGGGTGCCCTGTCCCCACTGCGGGCTGCCTCC
GATCCCCTGCTCTCTTCAGTGTCCCCTGCTGTCTCCAAGGCCAGCAGCCGCCGCAGCAGC
TTCAGCATGGAAGAGGAGTCCTGATCAGGCCTCACCCCTCCCCTGGGACTTTCCCACCCA
GGAAAGGAGGACCAGTCAGGATGAGGCCCCGCCTTTTCCCCCACCCTCCCATGAGACTGC
CCTGCCCAGGTATCCTGGGGGAAGAGGAGATGTGATCAGGCCCCACCCCTGTAATCAGGC
AAGGAGGAGGAGTCAGATGAGGCCCTGCACCTTCCCCAAAGGAACCGCCCAGTGCAGGTA
TTTCAGAAGGAGAAGGCTGGAGAAGGACATGAGATCAGGGCCTGCCCCCTGGGGATCACA
GCCTCACCCCTGCCCCTGTGGGACTCATCCTTGCCCAGGTGAGGGAAGGAGACAGGATGA
GGTCTCGACCCTGTCCCCTAGGGACTGTCCTAGCCAGGTCTCCTGGGAAAGGGAGATGTC
AGGATGTTGCTCCATCCTTTGTCTTGGAACCACCAGTCTAGTCCGTCCTGGCACAGAAGA
GGAGTCAAGTAATGGAGGTCCCAGCCCTGGGGGTTTAAGCTCTGCCCCTTCCCCATGAAC
CCTGCCCTGCTCTGCCCAGGCAAGGAACAGAAGTGAGGATGAGACCCAGCCCCTTCCCCT
GGGAACTCTCCTGGCCTTCTAGGAATGGAGGAGCCAGGCCCCACCCCTTCCCTATAGGAA
CAGCCCAGCACAGGTATTTCAGGTGTGAAAGAATCAGTAGGACCAGGCCACCGCTAGTGC
TTGTGGAGATCACAGCCCCACCCTTGTCCCTCAGCAACATCCCATCTAAGCATTCCACAC
TGCAGGGAGGAGTGGTACTTAAGCTCCCCTGCCTTAACCTGGGACCAACCTGACCTAACC
TAGGAGGGCTCTGAGCCAACCTTGCTCTTGGGGAAGGGGACAGATTATGAAATTTCATGG
ATGAATTTTCCAGACCTATATCTGGAGTGAGAGGCCCCCACCCTTGGGCAGAGTCCTGCC
TTCTTCCTTGAGGGGCAGTTTGGGAAGGTGATGGGTATTAGTGGGGGACTGAGTTCAGGT
TACCAGAACCAGTACCTCAGTATTCTTTTTCAACATGTAGGGCAAGAGGATGAAGGAAGG
GGCTATCCTGGGACCTCCCCAGCCCAGGAAAAACTGGAAGCCTTCCCCCAGCAAGGCAGA
AGCTTGGAGGAGGGTTGTAAAAGCATATTGTACCCCCTCATTTGTTTATCTGATTTTTTT
ATTGCTCCGCATACTGAGAATCTAGGCCACCCCAACCTCTGTTCCCCACCCAGTTCTTCA
TTTGGAGGAATCACCCCATTTCAGAGTTATCAAGAGACACTCCCCCCTCCATTCCCACCC
CTCATACCTACACCCAAGGTTGTCAGCTTTGGATTGCTGGGGCCAGGCCCCATGGAGGGT
ATACTGAGGGGTCTATAGGTTTGTGATTAAAATAATAAAAGCTAGGCGTGTTTGATGCGC
TTTTAACTTTG
gcaaagagtctcctgtccttgttttacactgtgcagtgaacatagcccatgcaggccaag
agggataaaagtccttgggagaaacagattccagaaggatggataaaagaatttagaaag
gaagagggcatggaggaagacaatatgcaaacaaaagacagtatttttaaagaccaatca