Gene SYP Variant 1
DNA : 12.38 KbNT_011568
mRNA : 2417 bp NM_003179
CDS : 942 bp NP_003170
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  36 bp
ggccggaatggctgccggtgagactgtggtacaacccgctgtgcgcaggcgcgtggcggg
caaggagggggcgcgaggggcggggctgcagccgcctgggctgttccaacgagcgcgcgc
cgcccccgccgcgccccgcgccgcccttgctagccgagcctcccgccccctgcattgctg
ATGCTGCTGCTGGCGGACATGGACGTGGTGAATCAG
gtacgcgctccagcaccgtggacagagcccgccgccgcccggctgcctaggccgggtcgc
tcaggccagccgactctgggaggtggtggccagggtctggcagcggagacccggtccccg
gcgctggggatgggggtctgcggcaggtgaaggggaggaagggggaggtggagaaaagga
EXON 2  66 bp
accttcccaccagtccttggaccctggggctcacaccatccccaaggtgtcactttctcc
ttctcaccctctccccgaggtcacatgctccatcccctggggtcattgatgggcagcctt
gccgctcacctccctgtacctccaacaaccccaccccttccccactgtttctctcctcag
CTGGTGGCTGGGGGTCAGTTCCGGGTGGTCAAGGAGCCCCTCGGCTTTGTGAAGGTGCTG
CAATGG
gtgagtgtggtccgggctgttggggcagagtgcagggagagagggaggtcatggggtcca
gaagagcaggggtggagtaggggcgagtagccagggatgagtgcgggggttgtaggggat
gggggaattgggctccagggtgaggtttcaggggtctgaagccagaaaacagatgagctg
EXON 3  125 bp
acagccatacccttgtaatcagcttgtccttggtcccgatgagccctgattagggggtgg
gggtggggactgctccatctgctgctgcctgtgctgggcccccgatctgtccagaggagg
gcacctccctcccacatgcacacaggttcactgtggccatccccatccctgctgcccaag
GTCTTCGCCATCTTCGCCTTTGCCACATGCGGCAGCTACAGTGGGGAGCTCCAGCTGAGC
GTGGATTGTGCCAACAAGACCGAGAGTGACCTCAGCATCGAGGTCGAGTTCGAGTACCCC
TTCAG
gtgtgctcccaccctgggataccaacagacctgggagaggaaggggcagggtggaaccgg
ccaatacctccccccgcaagtagctcctgcccagctcccacctcgaggctacatccactg
ggatcactgagcacctgccttgtacctggcactgctctggactctaggactatgtggtga
EXON 4  196 bp
tatctcaccaggatgttttgagcaatcagtgaaatgtgactggtacatagtaggtgctcg
atgaatggttatttcctcctcttcctggggccttgtcagaaatggggggacccatgattg
ggctggagggttgagggtgttctgaggggctgggccacacctgcccacctctgtttgcag
GCTGCACCAAGTGTACTTTGATGCACCCACCTGCCGAGGGGGCACCACCAAGGTCTTCTT
AGTTGGGGACTACTCCTCGTCAGCCGAATTCTTTGTCACCGTGGCCGTGTTTGCCTTCCT
CTACTCCATGGGGGCTCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAATAA
CAAAGGGCCCATGCTG
gtgagtccccacagccacttgcatgtagggaccatggggacacggaaccccagggacaca
gccatgctcacagaccacaccaaatcccagacaggcccacatgcaaacagccaccataac
agccacacatatagttgctgctgctattaatccacaccaggcatccgggacacagagtca
EXON 5  192 bp
tacacacacaagctcaagctgggagggccaccttcaggtgaaagtgttgtgggcttgaga
gctgaaaaggcaggggagagacaggcctcttctgggggacctgtgatccgaggaggcccc
agggcctagcgtgaagcagtccactcacagtgctgtcttcctcacccctgcctgccttag
GACTTTCTGGCCACGGCTGTGTTCGCCTTCATGTGGCTAGTTAGCTCATCGGCATGGGCC
AAGGGGCTGTCAGATGTGAAGATGGCCACAGACCCAGAGAACATTATCAAGGAGATGCCT
GTCTGCCGCCAGACAGGGAACACATGCAAGGAGCTGAGAGACCCTGTGACCTCGGGACTC
AACACCTCGGTG
gtaagccctgggtgctggctggaggagggagagtggaaaacagtacagtccggcatgggg
agtggtggagtgggagaataagaggagagtcaggggagatccaaggggtgtccctgaaga
acgcgtgccaacaacaacgttgaaggatgagctagcaattgtaaccactgtgacaccaca
EXON 6  331 bp
accccgccagaggtgatttttctgcacatcgacgttctcgcactgggactcagagagtct
gggtttcagaaacccccaccttgcggagcctacggattcattccccgcatgctcattcct
gcacgcagggccgccaaggcaatgggcggggtaccacagccgagccttgtctccctgcag
GTGTTCGGCTTCCTGAACCTGGTGCTCTGGGTCGGCAACCTGTGGTTCGTGTTTAAGGAG
ACAGGCTGGGCCGCCCCGTTCCTGCGCGCGCCTCCCGGCGCCCCCGAGAAACAACCGGCA
CCCGGGGACGCCTACGGCGATGCAGGCTACGGGCAGGGCCCCGGCGGGTACGGGCCCCAG
GATTCCTACGGGCCTCAGGGCGGCTACCAGCCTGACTATGGTCAACCAGCCGGCAGCGGT
GGCAGTGGCTACGGGCCTCAGGGCGACTATGGGCAGCAAGGCTACGGCCCGCAGGGTGCA
CCCACCTCCTTCTCCAATCAGATGTAGTCTG
gtgagtgaccggcgagcggtgcggccaaggagggtacaaggaaggagacgagcgggtcag
tgaaccaataagagtcaggggtagagagtacgtaaggcgtttactggggcaagtaaggac
tgaagtttgaaggagccaatcaagaggcagaactacctgctaagagctgaaaaactagct
EXON 7  1471 bp
acctaacccagtgggggcaaggtcaggtatatcttctcagcagaggcagctgggatgaag
ctggctccaggaaagaagaaaagacataaagccaggacaaaggcataacagcccaacccc
tatctgagggcgccacccatgtcagaccccctctcctttctgtgtcttttgtctctacag
GTCAGTGAAGCCCAGGAGGACCTGGGGGGGGCAAGAGCTCAGGAGAAGGCCTGCCCCCCT
TCCCACCCCTATACCCTAGGTCTCCACCCCTCAAGCCAGGAGACCCTGTCTTTGCTGTTT
ATATATATATATATTATATATAAATATCTATTTATCTGTCTGAGCCCTGCCCTCACTCCA
CTCCCCTCATCCACTAGGTGCCCAGTCTTGAGTGGGCCCCCTCTCTTACCCCGTCCCTTT
CCCTGCATCCCTTGGCCCCTCTCTGTTTACCCTCCCTGTCCCCTGAGGTTAAGGGGATCT
AAAAGGAGGACAGGGAGGGAACAGACCTCGGCTGTGTGGGGAGGGTGGGCGTGACTTCAG
ACTCTCTCCTCTCTCTCCCTCCACTCCTCCCAACTCTGGCCTTGGTTCCTCCAGCAATGC
CTGCCTGAACAAAGGCCGTTAGGGAAATCCAACTCCAGGGTTAAAGAAAGGCAGAGATTG
GGGGGGCTTGGGGTAGAGAGGACAGTTTAGGACCCAAGGTGGTCTTGGAGAGGAGGTGTG
GAGTGGAGGGGTCAGCAGGGGGGTTGGGTTCCAGACAGAGTGGATCTGGAGTCTGAAGGA
GAGGAGTGCGCTAGAGCATTCTGGGGTGGGGCTTGGAAGGGCGCTGAGGGCAGGGTTCTA
GAAGGGGCGAGGCTTTAAGCGAGGCAGAATGGTGGGCTCCAGAGTAGGTGGGTCTTGGAT
TGGTACCAGAGCCTATGGAAAGGGTGTGGCTTGGAACATTTGGGAGACTGAGCTTGATTC
TAAAGGGGACAGATCTTGAGCAAGGCAAGAAGTGGGATTCAGGAATGGGCCAAGCCAGGG
TTCCAGACAGGGTGGGGCTTAGAATGGGGCTTCCATGGTGGTTTCAGAAAGGGCAGCCCC
TCCCCATGGTGCAGTGAAGAAAATGTTTTACAATGGCTGGGTTTGGGCAGTGGAGAGGGG
ACTTGGATAGGAGCTTCCAGATGGGTTTTGTTAGGGGTGGGGGAGAATGGCTCTGGCTAC
GACTTGGGACGGAAGTGGCCTGAGAAGAGTCGAGTGATATGGCTTGTAGGGTGAGGCGTG
GGATCCAGAGAGAAGCACCCCACCACACACACCCTTCCCCACTCCCGTGATGAAACAGCT
AGGTTAATAGGAGGACAGAACCAACGGGTCTGTGGGACTGGCCCACCCCTCTTCCCCCTT
CCCCTGCGCCCTCCCTCCCTCCACACCTCCACCCGTCCTGGGGTGGTTGGAGGCCTGGTC
TGGAGCCCCTATCCTGCACCCTCTGCTATGTCTGTGATGTCAGTAGTGCCTGTGATCGTG
TGTTGCCATTTTGTCTGGCTGTGGCCCCTCCTTCTCCCCTCCAGACCCCTACCCTTTCCC
AAACCCTTCGGTATTGTTCAAAGAACCCCCCTCCCCAAGGAAGAACAAATATGATTCTCC
TCTCCCAAATAAACTCCTTAACCACCTAGTC
tacccggctctgatttctcagtgtgtctttttcgggcgccggggaggaggttggccgggg
gagaaaggagggagaggtggtgagaacaagctccacccggacccaccgaccgcagttcag
cttgctgcaccatttcaggccccttcaaaagtgttaggcagagcagcatcctctgggaag