Gene SLC9A6 Variant 1
DNA : 61.67 KbNT_011786
mRNA : 4454 bp NM_006359
CDS : 2010 bp NP_006350
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  360 bp
tcccggcagcgcctgtgggtgcgtgtgacctgggacagaggggcaaaggaacctggcaga
gcgagcttgggatgccgcggcccctttaagagcggcggcggcggcgcgcgctccgacggc
tacccccgggccccgcccctttcccgtgagccctcggggagtggtccgaccgcgggcggc
CGCCGGTGAGGTAGGGGCGGGAGGCGGGGGGAGACATGGCTCGGCGCGGCTGGCGGCGGG
CACCCCTCCGCCGTGGCGTCGGCAGCAGTCCCCGAGCCCGCAGGCTCATGCGGCCCCTTT
GGTTGCTCCTCGCAGTGGGCGTCTTTGACTGGGCAGGGGCTTCGGACGGCGGCGGCGGAG
AGGCTAGAGCCATGGACGAGGAGATCGTGTCCGAGAAGCAAGCCGAGGAGAGCCACCGGC
AGGACAGCGCCAACCTGCTCATCTTCATCCTGCTGCTCACCCTCACCATTCTCACAATCT
GGCTCTTCAAGCACCGCCGGGCCCGCTTCCTGCACGAAACCGGCCTGGCTATGATTTATG

gcaagttcctcaacccttgtcagccccttggcgctgcccctttctctgcccgccggctgc
ttcgcctcctctgctggccctgctcggcctacgttcggctccccttctaattccttccat
tttctgcctcgccttccccctaccccgcgtttctctgcctcaccccctttcctcttcagc
EXON 2  104 bp
ttgggctgtttgttgtatgaatttagtaatattttaaaacataactgcatttcatctaaa
aatcagttctgagctacagggaactaccgtaagagattttctcttatccatagttatgcg
tggggtacaaaagaagtggtctctgtcggcaagaagagcttatgttgttcttttttccag
GTCTTTTGGTGGGCCTTGTGCTTCGGTATGGCATTCATGTTCCGAGTGATGTAAATAATG
TGACCCTGAGCTGTGAAGTGCAGTCAAGTCCAACTACCTTACTG
gtaaatgttagtggaaaattttatgagtatatgctgaaaggagagattagttcacatgaa
ctcaataatgttcaagataatgaaatgcttagaaaggtaagttcttaaaggaaatctttg
aatcttttttgtgtctaactagcagcaaaatgatccaggagaaaataagtaatggatttt
EXON 3  78 bp
ctggtcgtttggttgagaagtagaatagaaactatcctatatgaaatatttttaagttag
cacagtaatgttcttgcctttgactagtttaacatatagtattttttctttttgatcatt
tgataatggaatatgaggtcttctagggaattgatctaaaataactctttattttaacag
GTTACTTTTGATCCAGAAGTATTTTTCAACATATTACTTCCTCCTATCATATTTTATGCA
GGTTATAGCCTGAAAAGG
gtaagtccttttgtctttcatatactttgaataatcttaaactcagtgggctttgtaata
tttgacacttcagaaatgggctgttctttccagattaccctcctttctcctctccttatc
ctttttagatgctgaaatttatacctgtacaagaatgctttctcttatttatcctagtga
EXON 4  77 bp
tatcctttttagatgctgaaatttatacctgtacaagaatgctttctcttatttatccta
gtgaataatgcatttaatcctagtgaataatgcatttcatattagcatagcatagaaaac
cttttctttttcaagtaactggtaagtattctaacagtgtaacttttttttttttgtcag
AGACATTTTTTTCGAAATCTTGGGTCTATCCTAGCATACGCTTTTCTTGGAACAGCAATT
TCTTGTTTCGTTATTGG
gtaagtattttaagcttaaaatactttgtggccttcaaattataattttaaaataatata
tttttgatttatgcagtgttatatattcctgactgggtctaaagacttttgcaatattca
cgtaggtaataagttgtttgaattttccttaaggccaaagtattaccatatttcaatgac
EXON 5  113 bp
tcacgtaggtaataagttgtttgaattttccttaaggccaaagtattaccatatttcaat
gacatgaattaaatttgggattagtcacaaagtactacagtaaacccatcttcttacttt
atcctaatttttttaacagttgatatttttttctaaagtaggactgtgtttattgaacag
GTCAATAATGTATGGCTGTGTAACGCTGATGAAGGTAACGGGACAACTTGCAGGAGATTT
TTACTTTACAGATTGCCTACTGTTTGGTGCCATTGTATCAGCAACTGATCCAG
gtatgttttatatgagtggagtttacatacttgaggtgcattgttttgcagtcaaataca
tgtgggtttttctttctttgaggtgtagaattcatgattagatacttccttagtactata
ctttctaattgtggaggaaaaaacaaaattcatgattccttttggcttcagcacaaattt
EXON 6  106 bp
aattagaaaagaaaaatatttatataaaattacggggtctttaatatggtaagagaatgt
ttattaggattgaattctaggaggaaatgaatttctaaataactctcagagtcatctact
gaggagaatatgttatatttgtaatgtctaagtattcctctgactctttttacttactag
TGACTGTTCTTGCTATATTCCACGAGCTTCAAGTTGATGTTGAACTCTATGCACTTCTTT
TTGGTGAAAGTGTCCTCAATGATGCTGTTGCCATAGTGCTGTCCTC
gtaagtgtttgttttcttattatattctgaatattaagtgtgagggtactaggaactgaa
agtcacttattgaataaagtacattatgaatggaaacatttggaagaatgaggcattttt
ttccctcttgaagaaatccatattttatagataaattggaaaatacagggaagagaaaaa
EXON 7  142 bp
ttttcttgctagccagatacattgcaggatttttgggtaattttgtccttattttggcaa
ttccaatcgaaagcttgtttttcttctccctctaatttcatctttcaagctctatactac
ataatgtttttttaaaagtaaaggttgttttcagaagtaaaagcagtctctcttctgtag
CTCAATAGTGGCATACCAGCCAGCTGGAGACAACAGTCACACCTTTGATGTCACAGCGAT
GTTCAAGTCTATTGGGATCTTCCTTGGAATCTTCAGTGGATCTTTTGCAATGGGTGCTGC
TACTGGAGTGGTGACAGCTTTA
atatccttttgttatatttatcttttcttgttaacataatatagtagttgaatgctgtat
tccgttgtttttcctagttctatgattagaattatgttagaattattaatcttataacta
agtacttggtttgaaaacattaagcaacagtctttgccaataaataaataaaagaactgt
EXON 8  106 bp
tgactcctcagtaagatgctcattttaaaagtctccctattctggtggtaccttattctg
agatttctgtgttagagaagctagagaacctttctttcatggttgccttgcttaaactgt
tattttttctagtcacacttttgtgttacaagatctcattactagccttaacagtcttac
GTGACAAAGTTCACCAAATTACGGGAGTTCCAGTTGTTGGAGACAGGCCTGTTCTTCTTG
ATGTCCTGGAGTACCTTCCTCTTGGCTGAAGCATGGGGCTTCACAG
gtaggtgacttgctccctttgattgtcaacccttaaaaggagtgactttgccagtcaatt
ttgctccaagtggatcagctccgttagtatttgaacatacttattgtggttgggatttag
gttgttgctttagaacataaaaaaaaattttcagtggaagtggttcctcttaacaaagta
EXON 9  89 bp
atttaggttgttgctttagaacataaaaaaaaattttcagtggaagtggttcctcttaac
aaagtaagtcacaaatgagaatttccagacaaagcctataatctactgtgaagaaagaac
ctcagtataaaaggtgggaaccatccttttatgtgaacttggaatttgttgtctttatag
GTGTAGTTGCAGTATTGTTTTGTGGCATCACACAAGCACATTATACGTATAATAATTTGT
CCACGGAGTCTCAGCATAGAACTAAACAG
gtaagaggaactttatagtttgtgaataggcttttccttctttcagcaaaatagaagtct
tttttactaaaaaaaaaaaatagtctttgatctgttcaagatgctatctactcattttgg
ctcctcttcctttgactctaaaagtaggtgggattggcaaaatgaagaatgacagcattt
EXON 10  114 bp
tggctttttctgcaggactagaaatgtcgtctccacatttgctcccttctgaaccacata
ttttgtgtgtatgcatgaagtttatatatatgagtgtctgttttaatatcttagtaatac
tcatgctttcaaattatgtaactttatttgctggactaatcttttacaatttcgtttcag
TTGTTTGAGCTTCTCAATTTCTTGGCAGAGAATTTCATCTTCTCCTACATGGGGCTGACA
CTGTTCACCTTCCAGAACCATGTCTTTAACCCAACATTTGTAGTAGGAGCATTT
gtatcctttattatgtgttttattttgaaaatatttttaattgagattttcatgtgggtt
ttgagtatgtggttcataagaatacatttaaatatatacagttttcctctgagtaaaaca
aataaggattccagctcttttttctagtctatttattttattatattctatttcaatttg
EXON 11  112 bp
tatagaaaatttccatcattgcagaaagttctgttggacagtgttatgttagacaatgga
accaagagactgtgtgttagaaactgagttccctaaaatagtctttcaccatcttgagtg
tatagtctaaataatattaatagtaaaatgaaatgatccttaacctattaataattttag
GTTGCTATTTTCTTGGGAAGAGCTGCCAATATTTACCCCTTGTCCCTCTTACTTAATTTG
GGTAGAAGAAGTAAGATTGGATCAAATTTTCAACACATGATGATGTTTGCTG
gtaagttgtaactttcttctcttgcccacttcaagcaaccattcacaatgcgtgtgccag
cttgatgtaacactgagatgttatgctggtcatataatactcctttatttttatattatt
tatttatttagagacactgtttcactctgtcgcccaggctgtagtgcagtggcacgatct
EXON 12  154 bp
gtgctgggattacaggtgtgagccaccatgcacagcctggacatatttaagtatgttaat
atttactgcatatttgttcacatgcttctaagtttttagaacgtgctttcttgctctgaa
tttatgaagcttgcattggtaatgagttattgaagaaataccttttctgttcccctgtag
GCCTTCGTGGTGCAATGGCATTTGCCTTGGCCATTCGAGATACTGCCACTTATGCACGGC
AAATGATGTTCAGCACCACGCTTCTGATTGTGTTTTTTACCGTGTGGGTATTTGGTGGTG
GCACCACTGCAATGCTGTCATGCTTGCATATCAG
gtaagtactaactagagacctcattttaagattaaattttaatttggtttatttttctgc
ctgttttcaatttttaatctttggagaatctgtaatgttttattttttccttttaaaaag
tatgtaatatatagtacagaaaaaggaaaatatatatgcaaaagaaaaattcattgttaa
EXON 13  31 bp
ctgttgctaaggaaagtggcaggagccaaaaatctgcatcaacagctatagagaagcaag
aaaacattaaccattccatagcttctgtgttgagaaaagtagttgcctgacaatgtatat
gtgtgaatagaccattttttggcttcaaaatctcatttgctctttgtctttctcctttag
GGTTGGTGTTGATTCAGACCAAGAACACTTG
gtaaatatgcgtttttgttgttcctggcatttctgtcaaatgtgcagtcatttggaaaga
aaacaatctactataaacttcaaccttctatttagatcctgtcctctttgcctcagcttt
ggaggaatgatatcattcctggcttttctcactgctccatagagacaaaaccaagtttgc
EXON 14  80 bp
aaacatttcaatttcctattccaaagctgcaatatacaaactattaaatttctaatgtta
cccttgttggagagtgtcttataatatagtagcctctatttctgattctccaaaggaatg
gctctaaataaatgttcatatctttgtatagatattgatttctgtattatctatctgcag
GGTGTTCCTGAAAATGAAAGGAGAACTACCAAAGCAGAGAGTGCTTGGCTTTTCCGGATG
TGGTACAACTTTGATCATAA
gtatccttaattgagggaaaaaaaaaaaggataatgtggacatagataattacagtttaa
tggaacaagtgttttgactattctcttcctggagcagaatataaaacctacctttcatct
tccctttccccatcagtgctgtggaaaaggaaacccacacagacagattcctcttcaaac
EXON 15  106 bp
tgataaaatacccctttgctgtttcactgccatcatgtgaggaggaaatgagaccataga
tgtgaaagccctttgctgtcctccgaagtggttactatactatgatggtgattattatca
aacgagttgctcttttaaatttgtaaagaaaggaccacagctcttccttaaccaccgcag
CTATCTGAAGCCTCTGCTGACCCACAGCGGGCCTCCGCTGACAACAACACTCCCTGCCTG
CTGTGGACCCATCGCCAGGTGCCTCACCAGCCCCCAGGCTTACGAA
gtaagttggttttatccaaaactaaattcttcagtaagttaaatttatctgctctgtgga
tgagtcactggttttattttattttggtttgtttttttgcctttgaggtataaattccat
gaaagggaatttaagcatattttgctcaaccagaaaatacactgaaacctataaatataa
EXON 16  2682 bp
gaggaactaaggatgccaagtcacgctgtattttaagccaaggtatggactttagacttt
atcctgagggcagtgggctaccacttaagggttttaatgggggatcctcgaaaatactcc
tattggaaatgtctcttgaacttctcaaaaattcttaaatcttactttatttgcatttag
AACCAGGAACAGTTGAAAGATGATGATTCTGATCTTATTCTCAATGATGGTGACATCAGT
TTGACATATGGAGATTCTACTGTGAACACTGAACCGGCCACATCCAGCGCCCCAAGGAGA
TTTATGGGAAACAGTTCTGAAGATGCCTTGGATCGGGAGCTTGCATTTGGGGACCATGAA
CTGGTCATTCGAGGAACACGCCTGGTTCTTCCAATGGATGATTCTGAACCCCCGCTAAAT
TTGTTAGATAATACGAGACATGGTCCAGCCTAAGCTTACTAATACTCACTTAGTGATTTG
TAAAATTTGCACATGTGATTGTGAAGAAATTTGTACTACCTAAAAGTCCCAGTGCATGTC
TCTGAATGTGTAAGCTATATAAATGCTATTTATATGGCATAGAAAGAATATAAATATCCT
GTACACGGCAGATTGTGAACAAACTATATTCCTTTAAGTTTTCCTGGTTGCACTCTGTAG
ACTGGATCTGTTTTAGGAAGTTACTTTCACAGTGATGTTGTGTGTTCTGTTAGTTTTATG
TCTCAGTTAAAGTGTAAAAAGTGACGGATTTTCTCTTTCTTAAACTTACCTGACACTTAA
CCAGAGTACCAGTTCTCGTGATGTGAATTAATTTTTTTGTGTGCTAGGGGAGGGAGAGTG
AGGAGGGAGTGTTATTTCCTTGGGAACCTAGGGAGGAGAGGTTCCTTTGTTGGGAAACTT
TTGTTGATAGCTGCTGCCTTTGTCCTGATCGTTTTCTTTCCCTTTTCTCTGGTGGCCTGT
TGTGGTGCAACGAGCTGATGGCATTTGATCTTGCCCCATTCAGGTTGGGGAGTGAAGTGT
GAGGACCCTTTTCCCCCGCTTGCTGTGAAAGCACAGATTCATTGACTACAGTACACTGTT
GTTCAGAAAAGAAGGCTGCAAATGACTTCTGAGACTTTATGTCTTTTCTTCCAGACCAAG
ACCGTAGAAGGAGTCACATCTAGCCGGCTTAGCCAAAGTACAGGTGTATATAGTTCAGGG
CACTTGATTTAGATTTGGAGGGGCTGGGGTGGGCAGAGAGCAAGAGGCGAGTAAAGAGAA
TGGTGGTTTCAGAGATCTCTCTTCCCAAATGTGTAAATATTCTATACCAGATAAGTTTAA
ATAAGAAATTTAATTGCTGCTTAATTTTTGATTATGTACTTTATCTGTATAGCAGGCTTT
GTCGTCAGAAGTTTTTATATCGATTTAAATTGCTGCTCTTTAGCAGCCAAACAGGAGCAA
AATGTAAAATTTTTGAACTTACTGTGTCTAATCATCATTTGTTAGTCTGTAGTTAATGTC
AACAGTTAATTTATGAACCCACGATCGTTCCACACTGCACCAAAGTCAGTCATAAGAGAA
ATCGAATATTCTGGAGCACTGATTGCAGCAGGGTGGCTCCTTTGTGTGCAGCAGGTGTAG
TAGTCTTCATTTTCATGGTACGTTTTAATATTAATTACCTAAGCTGCCATGCATTTTTTT
TTTTACAGTTCTCAAGGAAGAGCACAGAACAATTTCTCATTTCATATTTGGAGTATGAAA
GTAGATTCTATTTTGTAATGCTGATAATACCTAAAGATGCATTGAATGCTTGGAAGAATG
CTTTTTGATGTTGATTTTGACCTGTTCATGATTCAGAAGAAAAACAAACTTTTTTGGATT
TTTTTTCCCTCAGGTCTGAGTAGCATTGCCTTAAATCTTATCCAGTTAGAACATTGATTT
ATTTACATGATGTTCAGATTTTCCAGTGAAAAATACCCTTCTGAACAAAACATGTACTTA
CTCTCCGAAAGGCATCTATCTGTGCTATTGCAAACACTCCTTGAGATTTTAGGGGAATTC
TAATGTTGTACCCTTTCGTGGCAGCTTTGACTGTTGGCATAGCCATTTGTTATGTAGTGG
TAGCGACTTTCCTGCTATGCAGGAATCCCTCCCATGACGTGTATGTTTTACATGATGTGT
GCCTCTTCACGCAGTAAATAGTTTCTTGTTAATGTATGTTTGAGGAGTTTGAACGTCAGT
GTCACTTACCCACAAAGTTATTCAAGTTGTAAAAGGTTATACAATAATTTAACAACTACC
TTTTTTATTCTGTCGGGTTACTGACCTCACTTTATGTAAATACTTCGCATGACAAATTCA
GTAACTCGTCTATTTCAGCATGCATAAGACTTTTCACTAGGGAAACTGATAAAGCTTGAG
TCAACTAAATCTGCCTTCATACTTTATCAAGGGGAACCAAGCCTGCTGTGCTTACATCAG
CATCTGGAAGACTTTCCTCTCCTCTAATCTGTGTACACATCTCCAAGCAAGGAAGAAAAA
ACAAACTCTGCTCAGACGCCTATGAAACACCTGAATGAACTTTGATGAAGTACAGTCTGA
GTTACCATCATGCACAAGTAGAACTGCTCTTGGACTTGTTTTCCTGTTGTTTGTGGAACC
TACGCGTTTGAATGGCTTGAACGTTGCATCTTTTAAAGTTATTTTTTAAGGTTTCTTGGC
ATTTATCCTAGTTGTCCGTGTTTGGCAATGTGCTGTTAAAGTAATAGACTTTTAATCTTT
ATGTATTTTTTGTTTTCTCTGGAGTACTTGGACAGATGTTATAGTGGTTTCTTTTAGGAA
AATCTGTCATTAAAAAAGTTATAGCCTTGCAAATAACCACTC
acagtatttgagtcacagtttattttagtgagacgtaaagagtgctgacttcatttattt
ttctacctatatacctagtggaaaaggggaagactaatgttttcaaataaacaaacagaa
acctaacagaacttaacttatgggttggcaaatttttggtgcttatgtgtaagggtggat