Gene SLC6A8 Variant 1
DNA : 8.65 KbNT_025965
mRNA : 3918 bp NM_005629
CDS : 1908 bp NP_005620
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  900 bp
tctcctccccgggaggagggcagggaggaggtgggcggagtgtgacgaggagggcgggag
ggagggatgcgggagggggagggggaggggggccggccggccgtgggggtggggcgatag
tgacatcaccccggagtcggtttttaagcggcggccggccggggacggggaagagaggga
TAGTCGGAGCGAGGTGGCGAGTCGCTGAGCCCGCCGCGGCCCCGAGAGCGGCTGCAGCCG
CCGCCGCCGGGAAGGAGAGGGCGAGGCGCGCCCGAGCCGCCGCCGCCGCCGCCACCGCCG
CCGCCGCCACCACCGCCACCGGAGTCGCGGGCCAGCCGGGCAGCCTCCGCGGGCCCCGGC
CGGGGCGGGGGGCGCGGGCCACAGGCCCCTGCTCCGGCCGCCGCTTGCAGACCGCGGGCG
CCGATGTCGCCCGCGCCCCGCTAGGCTGAGCCTCGGGTCGGGCGAGGAGCCGCCGCAGCC
GCCGCCGCCCGAGCCGCGGGCAGGAGCCTCGGGAGCCGCCGCCGCCGCCGCCGCCGCCCG
GCCGGGCCCCGCCGCCGCCCGCGCGCCCCCGGGCCCCCGACACACATGAGATTCTTCAGG
CTCACTTTCAAGTGCTTCGTGGACTGCTTCTGACTGCGCCGCCCGCGCCCCGCACCCCGC
CGCCCGCCCGCCGCCCCGTCCCCCGGCCCGGCCGCCCCCCGGCCCCCGGCCGGCCCGCGC
CCTCGGGGCCCTCCCCGGTGCCGCCGGTGCCCCCCGCCTGACCGCCGCCCCCCGTGAGGC
GCCGCGACCCCGGCCCGGCCGTGCGGCCCGCCGAGGCCATGGCGAAGAAGAGCGCCGAGA
ACGGCATCTATAGCGTGTCCGGCGACGAGAAGAAGGGCCCCCTCATCGCGCCCGGGCCCG
ACGGGGCCCCGGCCAAGGGCGACGGCCCCGTGGGCCTGGGGACACCCGGCGGCCGCCTGG
CCGTGCCGCCGCGCGAGACCTGGACGCGCCAGATGGACTTCATCATGTCGTGCGTGGGCT
TCGCCGTGGGCTTGGGCAACGTGTGGCGCTTCCCCTACCTGTGCTACAAGAACGGCGGAG

gtgagttcccccgcccgccgcggcctcctcccccagcaggccgccggcccccgcccgacc
cccggagccgccgcggaggggtgaagtccgggcaacgggtggcccccgggcacgcggggg
tcggggccgcccctcgtccgccgctgccgctcggtggccgggccgggcgcctccaccccc
EXON 2  132 bp
cttcaacacactcaacccaccccctcaagactccacctggggcctgagtcagtggccacc
cctacactgactcacccagtcggaagttgtgatggggcctttggagtctgggctggcccg
ctgggcctgggcagcctggctgggggccaccctgagtccacgctgtgcctccacccccag
GTGTGTTCCTTATTCCCTACGTCCTGATCGCCCTGGTTGGAGGAATCCCCATTTTCTTCT
TAGAGATCTCGCTGGGCCAGTTCATGAAGGCCGGCAGCATCAATGTCTGGAACATCTGTC
CCCTGTTCAAAG
gtgagcagcccttggccagcctcagggactgcccccttctcccagctggctcccacttga
gaaatcttttcctgtcgtgagcaccaggcctggggccacgtgatggcgtcccagtctcga
ggggggagcctggaggagatgttcaggccgcacagcgaacttggggaagcggggactaga
EXON 3  250 bp
gggagtcagcgcagtgttggggctcacacaagggggagcccaggggagtcaggagcacca
caaacaaggctccaggaggacagatggtgggagcacggccagcctgggtggggacataaa
ggggtggcagggggaggtggccagggaagaatctacatggcaaggacttcccggccccag
GCCTGGGCTACGCCTCCATGGTGATCGTCTTCTACTGCAACACCTACTACATCATGGTGC
TGGCCTGGGGCTTCTATTACCTGGTCAAGTCCTTTACCACCACGCTGCCCTGGGCCACAT
GTGGCCACACCTGGAACACTCCCGACTGCGTGGAGATCTTCCGCCATGAAGACTGTGCCA
ATGCCAGCCTGGCCAACCTCACCTGTGACCAGCTTGCTGACCGCCGGTCCCCTGTCATCG
AGTTCTGGGA
gtgagtccggcacctctgggccaagcccatcccatcccccaggtctccctcatgttgccc
ggctccaggggagtggccctgagggggcaccagggtgttgcctggcagtccatcctggac
cctgcctgcccttgcctgtcctcggagagtcctggggccagcctcgctcctgggttcggc
EXON 4  133 bp
gatgggagtggcctcccaatggccaggggatcgtgggctccaggcccagcccaattggac
aagagggacccgctgaaccctgggctgtgggagagaagggagccacaactcctgggggtg
gaccctgtggctccatcctctgctggcacaggcctcatgggacctccctccctcccctag
GAACAAAGTCTTGAGGCTGTCTGGGGGACTGGAGGTGCCAGGGGCCCTCAACTGGGAGGT
GACCCTTTGTCTGCTGGCCTGCTGGGTGCTGGTCTACTTCTGTGTCTGGAAGGGGGTCAA
ATCCACGGGAAAG
gtaccactagaggcatgcagcggggagggtggctcagccctgggagccggatgtctgtgc
caggcacacctgtggcaacgggaggtgaccagacagagtctagccctaaggaagggggag
gtactgaaagccaagcaatgctccccaccctgcaaatccagggcccagcagcctttgctc
EXON 5  135 bp
gcacttggccagggctgccggggcgcagccttgcccctagcttcctctggcgggagccat
ggctcggaggacaatggggacctctgaacatacctgcccgcaagggggaccggaggcgct
gggagtgggggtgtgagggaggtggtgccacagcctccgctgagcagcctggccccccag
ATCGTGTACTTCACTGCTACATTCCCCTACGTGGTCCTGGTCGTGCTGCTGGTGCGTGGA
GTGCTGCTGCCTGGCGCCCTGGATGGCATCATTTACTATCTCAAGCCTGACTGGTCAAAG
CTGGGGTCCCCTCAG
gtgaggtggaggtggagaggctgcagcagggcgctgcgggggagccctgcaggcccctca
tgcctgcgctctccggcccttctctaggtgtggatagatgcggggacccagattttcttt
tcttacgccattggcctgggggccctcacagccctgggcagctacaaccgcttcaacaac
EXON 6  104 bp
gtgctgctggtgcgtggagtgctgctgcctggcgccctggatggcatcatttactatctc
aagcctgactggtcaaagctggggtcccctcaggtgaggtggaggtggagaggctgcagc
agggcgctgcgggggagccctgcaggcccctcatgcctgcgctctccggcccttctctag
GTGTGGATAGATGCGGGGACCCAGATTTTCTTTTCTTACGCCATTGGCCTGGGGGCCCTC
ACAGCCCTGGGCAGCTACAACCGCTTCAACAACAACTGCTACAA
gtaagcaccgccgccctgccacccgtgccctgtcctgccctgccccgccctgcccagcag
cctaacccatccactctggcccctccacccctcagggacgccatcatcctggctctcatc
aacagtgggaccagcttctttgctggcttcgtggtcttctccatcctgggcttcatggct
EXON 7  125 bp
cccagattttcttttcttacgccattggcctgggggccctcacagccctgggcagctaca
accgcttcaacaacaactgctacaagtaagcaccgccgccctgccacccgtgccctgtcc
tgccctgccccgccctgcccagcagcctaacccatccactctggcccctccacccctcag
GGACGCCATCATCCTGGCTCTCATCAACAGTGGGACCAGCTTCTTTGCTGGCTTCGTGGT
CTTCTCCATCCTGGGCTTCATGGCTGCAGAGCAGGGCGTGCACATCTCCAAGGTGGCAGA
GTCAG
gtagggccctacccccagccccgcctccagagcagcgagtgctacccagatgcatgatgt
acaggaacatgcaatagaaatgctgaaaagtgacgaggattcaaacggaacttgtcagat
tgtgggcctgtgggggcaggtcctgggatttgtcaatgttgacagagaaaggacctccca
EXON 8  117 bp
ggtcctgggatttgtcaatgttgacagagaaaggacctcccagcccctgccgcacgaccc
agggttgacagcgcctctgaggcaggcgtgggcatgggcgcgagtgttgcaggcagggct
cagggtgcgcacagggcaggacatcggctacaaggtctagagcctgcacctttcccacag
GGCCGGGCCTGGCCTTCATCGCCTACCCGCGGGCTGTCACGCTGATGCCAGTGGCCCCAC
TCTGGGCTGCCCTGTTCTTCTTCATGCTGTTGCTGCTTGGTCTCGACAGCCAGGTTT
gcatggggctctgggacagggagccaggaggggggcggagggagggctgcaggcaaggaa
aggggtggagggcggtgcggggctcggcctgagctgccctggccacagtttgtaggtgtg
gagggcttcatcaccggcctcctcgacctcctcccggcctcctactacttccgtttccaa
EXON 9  135 bp
cagtggccccactctgggctgccctgttcttcttcatgctgttgctgcttggtctcgaca
gccaggtttgcatggggctctgggacagggagccaggaggggggcggagggagggctgca
ggcaaggaaaggggtggagggcggtgcggggctcggcctgagctgccctggccacagttt
GTAGGTGTGGAGGGCTTCATCACCGGCCTCCTCGACCTCCTCCCGGCCTCCTACTACTTC
CGTTTCCAAAGGGAGATCTCTGTGGCCCTCTGTTGTGCCCTCTGCTTTGTCATCGATCTC
TCCATGGTGACTGAT
gtgagtggggtggggggtctgcctgtgacctctggtggccgtctgccatcctccctgact
gggctctgtcccccagggcgggatgtacgtcttccagctgtttgactactactcggccag
cggcaccaccctgctctggcaggccttttgggagtgcgtggtggtggcctgggtgtacgg
EXON 10  103 bp
tcgacctcctcccggcctcctactacttccgtttccaaagggagatctctgtggccctct
gttgtgccctctgctttgtcatcgatctctccatggtgactgatgtgagtggggtggggg
gtctgcctgtgacctctggtggccgtctgccatcctccctgactgggctctgtcccccag
GGCGGGATGTACGTCTTCCAGCTGTTTGACTACTACTCGGCCAGCGGCACCACCCTGCTC
TGGCAGGCCTTTTGGGAGTGCGTGGTGGTGGCCTGGGTGTACG
gtaggtcatggctgagggctgggctgggggatggtggcggggaaggcaggtctccagctt
ggccctcccgcctcacctcgccgcaggagctgaccgcttcatggacgacattgcctgtat
gatcgggtaccgaccttgcccctggatgaaatggtgctggtccttcttcaccccgctggt
EXON 11  101 bp
tacgtcttccagctgtttgactactactcggccagcggcaccaccctgctctggcaggcc
ttttgggagtgcgtggtggtggcctgggtgtacggtaggtcatggctgagggctgggctg
ggggatggtggcggggaaggcaggtctccagcttggccctcccgcctcacctcgccgcag
GAGCTGACCGCTTCATGGACGACATTGCCTGTATGATCGGGTACCGACCTTGCCCCTGGA
TGAAATGGTGCTGGTCCTTCTTCACCCCGCTGGTCTGCATG
gtaagggctgggggaggtggggcagggcggggggcgaggcagggcggggtaggggcccca
ttaaccgcagcattctggtccgtagggcatcttcatcttcaacgttgtgtactacgagcc
gctggtctacaacaacacctacgtgtacccgtggtggggtgaggccatgggctgggcctt
EXON 12  171 bp
accgcttcatggacgacattgcctgtatgatcgggtaccgaccttgcccctggatgaaat
ggtgctggtccttcttcaccccgctggtctgcatggtaagggctgggggaggtggggcag
ggcggggggcgaggcagggcggggtaggggccccattaaccgcagcattctggtccgtag
GGCATCTTCATCTTCAACGTTGTGTACTACGAGCCGCTGGTCTACAACAACACCTACGTG
TACCCGTGGTGGGGTGAGGCCATGGGCTGGGCCTTCGCCCTGTCCTCCATGCTGTGCGTG
CCGCTGCACCTCCTGGGCTGCCTCCTCAGGGCCAAGGGCACCATGGCTGAG
gtaaggctcccgcccggcccgccctcccctcccctgctgtgaacattcaacccagcctgc
ttcctagccagggagtggccccgactagggtggcaggcagtgggaaccggagagaggcag
aggaagtcaccgtggggacgagcaggtgaccctgggggcttcagcatgtcctcctctcct
EXON 13  1512 bp
ggctcccgcccggcccgccctcccctcccctgctgtgaacattcaacccagcctgcttcc
tagccagggagtggccccgactagggtggcaggcagtgggaaccggagagaggcagagga
agtcaccgtggggacgagcaggtgaccctgggggcttcagcatgtcctcctctcctgcag
CGCTGGCAGCACCTGACCCAGCCCATCTGGGGCCTCCACCACTTGGAGTACCGAGCTCAG
GACGCAGATGTCAGGGGCCTGACCACCCTGACCCCAGTGTCCGAGAGCAGCAAGGTCGTC
GTGGTGGAGAGTGTCATGTGACAACTCAGCTCACATCACCAGCTCACCTCTGGTAGCCAT
AGCAGCCCCTGCTTCAGCCCCACCGCACCCCTCCAGGGGGCCTGCCTTTCCCTGACACTT
TTGGGGTCTGCCTGGGGGAGGAGGGGAGAAAGCACCATGAGTGCTCACTAAAACAACTTT
TTCCATTTTTAATAAAACGCCAAAAATATCACAACCCACCAAAAATAGATGCCTCTCCCC
CTCCAGCCCTAGCCGAGCTGGTCCTAGGCCCCGCCTAGTGCCCCACCCCCACCCACAGTG
CTGCACTCCTCCTGCCCCTGCCACGCCCACCCCCTGCCCACCTCTCCAGGCTCTGCTCTG
CAGCACACCCGTGGGTGACCCCTCACCCCAGAAGCAGCAGTGGCAGCTTGGGAAATGTGA
GGAAGGGAAGGAGGGAGAGACGGGAGGGAGGAGAGAGAGGAGAAGGGAGGCAGGGGAGGG
GCAGCAGAACCAAGGCAAATATTTCAGCTGGGCTATACCCCTCTCCCCATCCCTGTTATA
GAAGCTTAGAGAGCCAGCCAGCAATGGAACCTTCTGGTTCCTGCGCCAATCGCCACCAGT
ATCAATTGTGTGAGCTTGGGTGCGAGTGCACGCGTGCGTGAGTACGGAGAGTATATATAG
ATCTCTATCTCTTAGCAAAGGTGAATGCCAGATGTAAATGGCGCCTCTGGGCAAAGGAGG
CTTGTATTTTGCACATTTTATAAAAACTTGAGAGAATGAGATTTCTGCTTGTATATTTCT
AAAAAGAGGAAGGAGCCCAAACCATCCTCTCCTTACCACTCCCATCCCTGTGAGCCCTAC
CTTACCCCTCTGCCCCTAGCCAAGGAGTGTGAATTTATAGATCTAACTTTCATAGGCAAA
ACAAAAGCTTCGAGCTGTTGCGTGTGTGAGTCTGTTGTGTGGATGTGCGTGTGTGGTCCC
CAGCCCCAGACTGGATTGGAAAAGTGCATGGTGGGGGCCTCGGGGCTGTCCCCACGCTGT
CCCTTTGCCACAAGTCTGTGGGGCAAGAGGCTGCAATATTCCGTCCTGGGTGTCTGGGCT
GCTAACCTGGCCTGCTCAGGCTTCCCACCCTGTGCGGGGCACACCCCCAGGAAGGGACCC
TGGACACGGCTCCCACGTCCAGGCTTAAGGTGGATGCACTTCCCGCACCTCCAGTCTTCT
GTGTAGCAGCTTTAACCCACGTTTGTCTGTCACGTCCAGTCCCGAGACGGCTGAGTGACC
CCAAGAAAGGCTTCCCCGACACCCAGACAGAGGCTGCAGGGCTGGGGCTGGGTGAGGGTG
GCGGGCCTGCGGGGACATTCTACTGTGCTAAAAAGCCACTGCAGACATAGCAATAAAAAC
ATGTCATTTTCC
aaagcaggctcctgcttccgcctctgctgctctaaggaaggggtcggggtacaggaggca
gggggaacctcctccagctggagctgctgccgtgagcaaggctctgctctggaggcctct
gcggccggcacccttctggggactgggaagggggcagggaaggcagcagcccaggggaag