Gene SLC25A5 Variant 1
DNA : 2.87 KbNT_077819
mRNA : 1225 bp NM_001152
CDS : 897 bp NP_001143
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  181 bp
ggcggcgcggagagcagtcccggcccgccctccacgactcctcctcctgcgagctgggcc
actcagcggctctgccgcccagcgcgccggggcccagaccccgccccggccccgcctccg
acgcctgccgctccagctccggctccccctatataaatcggccatttgcttcgctccgcc
CCGCAGCGCCGGAGTCAAAGCCGGTTCCCGGCCCAGTCCCGTCCTGCAGCAGTCTGCCTC
CTCTTTCAACATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGT
GGCCGCAGCCATCTCCAAGACGGCGGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCA
G
gtacgtcctgggatccaggagcccaaccaggaagtggggggaagggtcgcacagaaggcg
ggcgcccgaggggtggcggggagcgaactctaaagacatggccagggaagcggcttagga
gaggccagagcggggcgcagaggcagaacagaagtcaaactggtgggaggcgcctttagt
EXON 2  487 bp
cacctcttcccctgtgacagcctcagagggttgggagggtccagccagtatgatatacga
agactagatttgagagaggggagcctaccttaaagggcattgatcgagatggcataagct
cttctctttcccttccccatggttataactgtccctgttggcttccttcctgtctgttag
GTGCAGCATGCCAGCAAGCAGATCACTGCAGATAAGCAATACAAAGGCATTATAGACTGC
GTGGTCCGTATTCCCAAGGAGCAGGGAGTTCTGTCCTTCTGGCGCGGTAACCTGGCCAAT
GTCATCAGATACTTCCCCACCCAGGCTCTTAACTTCGCCTTCAAAGATAAATACAAGCAG
ATCTTCCTGGGTGGTGTGGACAAGAGAACCCAGTTTTGGCTCTACTTTGCAGGGAATCTG
GCATCGGGTGGTGCCGCAGGGGCCACATCCCTGTGTTTTGTGTACCCTCTTGATTTTGCC
CGTACCCGTCTAGCAGCTGATGTGGGTAAAGCTGGAGCTGAAAGGGAATTCCGAGGCCTC
GGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAAGGGCCTGTACCAAGGCTTT
AACGTGTCTGTGCAGGGTATTATCATCTACCGAGCCGCCTACTTCGGTATCTATGACACT
GCAAAGG
gtaagtttgctgtgggctttaacgttgtgttcttaggagacagtttaaaagagcattgta
ccaacctaacagtccaagagctaaagagttgtttttttaattgctaaaggaagccaagat
catccaatgcaacccttgtgtacagatgacgtgtttaggggatgtggggaaaggaagtca
EXON 3  141 bp
taaaagagcattgtaccaacctaacagtccaagagctaaagagttgtttttttaattgct
aaaggaagccaagatcatccaatgcaacccttgtgtacagatgacgtgtttaggggatgt
ggggaaaggaagtcagtaaaactctgctttttggtaaaagcatctctttcctattcccag
GAATGCTTCCGGATCCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTG
TCACTGCTGTTGCCGGGTTGACTTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGA
TGCAGTCAGGGCGCAAAGGAA
gtaagttccacttgagcagaagataaagttgtagtcgtggggcaatctgctgccacaaac
tggtgatacatacctttaaaatggctgtctgtccaagtcaagggatggggttgatagcat
ctgtgtctgttccacaactgcctttgagctggcccttcagatgcctatgaatgagggtgc
EXON 4  416 bp
tgggtagtctgtattcctgtggtcatagcattaatatttcagtgttgcccatgctaatgt
gtgaatgttggatttaaagctgacgttcttagaggtggggctctgctttatttagcctag
tgaatcttaggatttttcatcggccttcagtcactaactccatgtctttattctttgcag
CTGACATCATGTACACAGGCACGCTTGACTGCTGGCGGAAGATTGCTCGTGATGAAGGAG
GCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAGGCATGGGTGGTGCTTTTG
TGCTTGTCTTGTATGATGAAATCAAGAAGTACACATAAGTTATTTCCTAGGATTTTTCCC
CCTGTGAACAGGCATGTTGTATTATATAACATATCTTGAGCATTCTTGACAGACTCCTGG
CTGTCAGTTTCTCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATC
TGACCAGTTTTCTCTTAAAGCCATTTCCATGATGATGATGATGGGACTCAATTGTATTTT
TTATTTCAGTCACTCCTGATAAATAACAAATTTGGAGAAATAAAAATATCTAAAAT
aaattttgtctgcagtatattttcatataaaaatgcatatttgagtgctacattcgaata
aatactacctttttagtgaatgctacatttttaataaatgctacagtatctccggagatg
aagaactgtctttttaaaaccaattgtcagcagtccgcttaacagaataacttggttgtg