Gene RPS6KA3 Variant 1
DNA : 111.27 KbNT_011757
mRNA : 2259 bp NM_004586
CDS : 2223 bp NP_004577
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  69 bp
cggcgtcgagccctctctggggccgccgccgctgctgctgctgctgccgctgccgctgcc
gctgccgccgccgccgccgccgccgccgctgccgtggggctcgggcggcgacggagcggg
gccggccgtggggcgggcggggagggaggaggcggtgaaggcggcgggccgggggggaag
ATGCCGCTGGCGCAGCTGGCGGACCCGTGGCAGAAGATGGCTGTGGAGAGCCCGTCCGAC
AGCGCTGAG
gtgagtgcagcagggcggccggggccggcgcatctcctcctcgcgcccccgccggctcgc
ttcgctccccggagctggccactcggcccgttctgatcccgctcgcgtctttcccccggg
ctcagggttttggtttgggttgttggggtgggtctattggccggtctgtctgttccttcc
EXON 2  57 bp
ttttgaagcacatcctgttgcaaatttagcaactgcatactcatatggtggttctacttc
attagagccctttaggggtgaaaatcttcctcaattttttttttttttgtctgccttcat
ttaactttaactgatgtgaggtctgttttggtaacttcctgcttgctgtgcttttcacag
AATGGACAGCAAATTATGGATGAACCTATGGGAGAGGAGGAGATTAACCCACAAACT
gtaagtaaaatattttatcacaaagggtatagataaatgaaatactgtaaagttattatt
atttttcagctgagcagagtaatcattttacagtgttagaaacttgtcgatcctttcaca
ttaactttaccagactacattattgagtatgccagggacctttctaaaaactgtttgata
EXON 3  117 bp
tcacttgatgggttggtaaaaggtggtttttgtatgttaatttgggatttctaatatgtt
tagaaattagattgatttctaattaatttctagtaagattaaattaatattgtttgattt
ttagcgggagaaaatagctctggctaaccctgtttgctcctcttacgtttatctcaacag
GAAGAAGTCAGTATCAAAGAAATTGCAATCACACATCATGTAAAGGAAGGACATGAAAAG
GCAGATCCTTCCCAGTTTGAACTTTTAAAAGTATTAGGGCAGGGATCATTTGGAAAG
gtaagtcatgagtgtgtgcttttttaagagttgtcttttcaattcatatgtatttcatat
acatgaggaaacaaatattttatgaaatgctaccagtcttcctaccagcaatgttttctg
tttttttacatttctcactatcagtaagtgggaaagtgaataaagttgttcaaaagtacg
EXON 4  82 bp
ccccaagttataacaaatgtttataactagtatttataattgatacattttaggggaaat
aatctacagtatatctgaatctatattataataataaactgtattatagcagggtcttat
tttaacaaggatatagtttatactactttgtaatatttattttctcttacttaaatgcag
GTTTTCTTAGTTAAAAAAATCTCAGGCTCTGATGCTAGGCAGCTTTATGCCATGAAGGTA
TTGAAGAAGGCCACACTGAAAG
gtaagtgttgctgctatttgtaatgttcatgtagtctaaacaaactgaaaggtctcaata
gagctcatgggactccttggcatgttatttacattctgaataggttcctgttaccagctt
taaatttaggctgacttttagtgaatttttcctgctaggctaggaatcatataactagtg
EXON 5  81 bp
tttggttatgtaatgtagtaaaagacatcattattgattttgtaaattcaagaatgataa
aacattcacattttaatacacataagcaaaattttatttaacatgggcaccaaaaagaat
ttgttttgaagattatctttgaaagatattacaatgtagcatacatacaatcttttatag
TTCGAGACCGAGTTCGGACAAAAATGGAACGTGATATCTTGGTAGAGGTTAATCATCCTT
TTATTGTCAAGTTGCATTATG
gtaagtatgagccgtctcccacatcatcccttgacctcatccctcaaaatccctgaggac
attcagataaactaatataaataaatatatatttgtatgtggttagcagatctatatagt
aataagtcatgaaaattaagccattatttcttagacaaactttagaagcttttattgttt
EXON 6  80 bp
aaacactgtatttaacatttccacatggaaactaagataaatcagtggttttcttctaag
taaaagtaagtttggacatttgatataattaatttgttaaaatattcatttatgaatgac
ctaatgtaaacctaaaaaaattatggtggactaaatgaaaattttcatttcttcattcag
CTTTTCAAACTGAAGGGAAGTTGTATCTTATTTTGGATTTTCTCAGGGGAGGAGATTTGT
TTACACGCTTATCCAAAGAG
gtatataattaatctctatttttagtctatttacatgcatcctgtttgaactaaagcttt
gttatgtttcagtattatgcttactgtattttctctagtggcacaagattctggaagaat
cagacccaaaaagagttcttttcctaccttttgaatttattctgaaagcaggactttaaa
EXON 7  107 bp
aagtgattggttgactgattagataattttgctattcctttcacgaataaattgtaaaca
aagctatgtataattatcatatttataaaatttttaggatatttaaactctagagtggaa
ctttaaaaattacagacacaaaaagaaaataaatttagaaaaattattgttttattttag
GTGATGTTCACAGAAGAAGATGTCAAATTCTACTTGGCTGAACTTGCACTTGCTTTAGAC
CATCTACATAGCCTGGGAATAATTTATAGAGACTTAAAACCAGAAAA
gtaaggaatcatgctactaagttgaatacaatgtaatatgattgtttaggagattataaa
aaatcaagtggcttcatgaaactcccacagtattgcactagcgtgcctgtgcttcacatc
tctgctaacactgtagtttcatactttaaaaatctcagttaatcaaaaaatactgttttt
EXON 8  38 bp
tgttataaatgtgtgtccaaaaaataatttgttcctcctttgcctttgccatcttattca
cagtctaaagcaatgttttagagtaaatgtggtgatctgatgcttaaggatgtaatttca
gtcttagcttctataaatctctatttagtgttcttaaaagattttctttgtttttttcag
TATACTTCTTGATGAAGAAGGTCACATCAAGTTAACAG
gtaaaaaaaaaatcctcgttttattaaaatattttctcctacaatatatactttccttta
aggttgattgtggtacaaatattgagtaatacactgtattaaaattaaaaacttgtatta
gggccaggcgtagtggctcacccctgtaatcccagcattctgggaggctgaggcaggtgg
EXON 9  143 bp
agtgagccaagatggcgtcactgtactccagcctgggtgacagagcgagactctgtctca
aaaaacaaacaaacaaaaaaaacttgtattagaaattttaaatgattaatgtcagaactc
aaagtttaaaatttacatgtgcaaatttatgtaggatatttatgatatttgttttggcag
ATTTCGGCCTAAGTAAAGAGTCTATTGACCATGAAAAGAAGGCATATTCTTTTTGTGGAA
CTGTGGAGTATATGGCTCCAGAAGTAGTTAATCGTCGAGGTCATACTCAGAGTGCTGACT
GGTGGTCTTTTGGTGTGTTAATG
gtaaggtttgaatttgggattttttagaggggaaggagattgttaagtgaggatcagcag
tgaatgttaaagaaactggtgtttttattttctttattttatgccatatgtaataaataa
ccaagaaacattattgcatgcagtatagaaggactatgaaatctgttagctgcgtctatc
EXON 10  71 bp
tgttttaggaattatcaagaacttcagtaacgaatatggtagaaatagaaaacacttgtt
atgtagcaattttagaatatttggttataattaaaatgatgcttttttttttttttacct
tctggccttcagattttatatttattgactaacacttctgattattttgcctttctgtag
TTTGAAATGCTTACTGGTACACTCCCTTTCCAAGGAAAAGATCGAAAAGAAACAATGACT
ATGATTCTTAA
gtaagtactcccttaatatagatgttttgatgagattttaaaataaatgcttcaggctgg
gcgctgtggctcatgcctgtaatcccagcactttgggagggcaaggaagacggatcactt
gagatcaggagtttgagaccagcctggccaacatggtgaaaccccatctctactaaaaat
EXON 11  89 bp
gttttgtaagatgttaccattgggggaaactgggtaaagggcacaggggatctctctgta
ttatttcttacaactgagtgtgaatctacaagtatctcaaaaagtttaatttaagaattt
ttaaaaataaaaatacagatgcctccaaaaaataaaatattatgtggatttattatttag
AGCCAAACTTGGAATGCCACAGTTTTTGAGTCCTGAAGCGCAGAGTCTTTTACGAATGCT
TTTCAAGCGAAATCCTGCAAACAGATTAG
gtaaaaattttaactaatttgtttatgttgtatgtttgttggtgtttgtttttagcgggg
agtagatatttgttttgtggtggaattattaactatttagacaaggctaggcctggtggc
tcacgcctgtaatcccagcactttgggagaccaaggcgggagaattacttgagtccagga
EXON 12  65 bp
ttgaggctgcagtgaactgagatcacaccactgcgctccagcctgggtgacagagcaagc
ccttgtctcaaaattaattaattaattaattaattaattagacaagtattgaaaacaaag
gctgagcaatatgtatatttctccttgaaataaaattatcagtgaatccatttttgatag
GTGCAGGACCAGATGGAGTTGAAGAAATTAAAAGACATTCATTTTTCTCAACGATAGACT
GGAAT
gtaagtatagaatgaaaacttgcttgaaatatttctttataattaaaatatgtctaagtc
tcttttttttttcccctccagaaactgtatagaagagaaattcatccgccatttaaacct
gcaacgggcaggcctgaagatacattctattttgatcctgagtttactgcaaaaactccc
EXON 13  103 bp
gaaataaaattatcagtgaatccatttttgataggtgcaggaccagatggagttgaagaa
attaaaagacattcatttttctcaacgatagactggaatgtaagtatagaatgaaaactt
gcttgaaatatttctttataattaaaatatgtctaagtctcttttttttttcccctccag
AAACTGTATAGAAGAGAAATTCATCCGCCATTTAAACCTGCAACGGGCAGGCCTGAAGAT
ACATTCTATTTTGATCCTGAGTTTACTGCAAAAACTCCCAAAG
gtaaggagaaaatgtgaaaatccaaatataagacaacaaatatgtttttttcttgtttca
tcagaaaatcttttccagactctgggcgcggtggctcacacttgtaatcccagcactttg
ggaggctgaggcgagcagatcgcttgaggccaggagttggagaccagcttggccaacata
EXON 14  125 bp
caatacacaatcagaacagatctgatacagtgcctcacaggtatcctggaaagcaagagg
tatatactgtgtacctgagaaatagaattccagaataagtgaaaaaggtcatagtgtcaa
cagtttttcccttaatttcctttcaaatgaatcttctttgtcacttcttactcttttcag
ATTCACCTGGCATTCCACCTAGTGCTAATGCACATCAGCTTTTTCGGGGGTTTAGTTTTG
TTGCTATTACCTCAGATGATGAAAGCCAAGCTATGCAGACAGTTGGTGTACATTCAATTG
TTCAG
gtgagtggatgtctaaataattttagatttggaatgttgtaagatatagttcattctgtg
aatagatctttttctactgacttcaagtgagcaatttaaaatacattttagactgggcat
agtggctcacacccgtaatcccagcactttgggaggccaaggcagttggatcacttgagg
EXON 15  126 bp
tcattgtaaacactttcaaaatcacttgtttgtagaataataagtactataaagatgtat
ttttattcttattcatttatatgtagggcatcaacaatgcatgctgagtaacatacttcc
ctattataaaatgcactaaaggcattatgggactcttcaccaatttataattttttgtag
CAGTTACACAGGAACAGTATTCAGTTTACTGATGGATATGAAGTAAAAGAAGATATTGGA
GTTGGCTCCTACTCTGTTTGCAAGAGATGTATACATAAAGCTACAAACATGGAGTTTGCA
GTGAAG
gtaaattttttttatttaaaatgcaattcatacagttcttgttcatgcatgtcagtacca
gttaaaaattacactccccttgttgttaaaagtgccttttgttataaaaaagttaaatat
ctggctagtgatcttcagagatcttaatctagaaccctgtgagctaaaggtaaggtggtt
EXON 16  90 bp
ctatatcaagactggctttctgattaaacaatctggccaggtagttgaataaaactgact
gataaatggcttatttatacactatttacatgaggtaatacccaaggtctgtagctataa
acaattaatgtttataactgtatagttgatgaggttttgtgataaacatttgccttttag
ATTATTGATAAAAGCAAGAGAGACCCAACAGAAGAAATTGAAATTCTTCTTCGTTATGGA
CAGCATCCAAACATTATCACTCTAAAGGAT
gtaagtagattctttaatatggatcatttgaatcagttgtctaactcacattgaaagtag
tgtattttcaaaaatcatgtggtagacaaagaactcatcataggctgggcacagtggccc
acgcctgtaatcccagcagtttgggaggccaaggcaggaggatcacttgaggccaggagt
EXON 17  159 bp
tgcagtgagccaagattgtgccagtgcactcctgggcgacagagtctgtctcaaaataaa
taaataaataaaatttgtcttgaatatgaagtgagtttaatttttcctttatattttaaa
cttcgttttgggcacatatagtttcaaataatatttacattttgatgttgaaatttatag
GTATATGATGATGGAAAGTATGTGTATGTAGTAACAGAACTTATGAAAGGAGGTGAATTG
CTGGATAAAATTCTTAGACAAAAATTTTTCTCTGAACGAGAGGCCAGTGCTGTCCTGTTC
ACTATAACTAAAACCGTTGAATATCTTCACGCACAAGGG
gtaagtctttttaccactctatatgtacatacacacacttttttcctttatgtttgagct
agaattagatagaaattactttatgcctgaaatggaaaataactgctattagctgaatta
tcctactgaccttcctctatataaacttttattattgagattgaagtgtacctttgatat
EXON 18  162 bp
tgcccccggtctatgttagagagttatgctttacattatcagtattttataatgttaggc
taatttaaaggtcagcactcatcatcttgttaagtgcattgcttgacagtttgtgaataa
agaactttcagtaatggaaatatattgttaacataactctttaatttgtatttcaattag
GTGGTTCATAGAGACTTGAAACCTAGCAACATTCTTTATGTGGATGAATCTGGTAATCCG
GAATCTATTCGAATTTGTGATTTTGGCTTTGCAAAACAGCTGAGAGCGGAAAATGGTCTT
CTCATGACTCCTTGTTACACTGCAAATTTTGTTGCACCAGAG
gtaattgtgagagagtttgcttgcagtattagtatgttttaaaactcattcactatgttt
aataccgaattattaataataatttaattgaagacttactgaagaaataattaggataaa
atgccagcctttcatttccctgtttaatgtttcagtgacatctgattgcctacagaagaa
EXON 19  77 bp
tatgaattattagtagtagaatgttctagaatcggattaacgtattgccttatttggtaa
ccatgttctgttgaaattttccttataggtgttgatttggaatatataattcaactcata
gccttacaaatatatatacaaaatggtggtatagtaatactaattttgcactttttctag
GTTTTAAAAAGACAAGGCTATGATGCTGCTTGTGATATATGGAGTCTTGGTGTCCTACTC
TATACAATGCTTACCGG
gtgagtgtataccatatgttctaagcacctaagcatttgttcatcaatgttttgcttaag
ttatctaggtttttgttttgtttggggttttttgtttgtttgtttgctttttctttagag
acagggtctcactctgttgcccaggctggagtacagtgacacagccatagttcactatag
EXON 20  118 bp
tataattaatattttataacctatactttacctggtgccttatggagcttcattttgttg
atttttttcactttggtagattttaataaaatattacattaactgaattagagtactttt
gagattaccaaccaagtaataaattttattcattaatattttaattttattataaattag
TTACACTCCATTTGCAAATGGTCCTGATGATACACCAGAGGAAATATTGGCACGAATAGG
TAGCGGAAAATTCTCACTCAGTGGTGGTTACTGGAATTCTGTTTCAGACACAGCAAAG
gtaagtatcacttcctattataagattttgagaaaataactttttatgatccatagtgag
aagaaatactaccagttagaaacctttgtttataaattagtatgttaaactgatgttaac
aaataatttgaactcgaaaatggacccattattttgtttcttccccagctgacattggtt
EXON 21  141 bp
atttagcagggaaaaagcggagactgattttttttcccccaaattaccatgttgaccaaa
gggctgctaccagaaaaagcagtatcacagaagctaaggaagaatgttcattagtatcaa
gagccatagaaaaagaagcaaaacaaaaggtttaagcttgttttattattcccattacag
GACCTGGTGTCAAAGATGCTTCATGTAGACCCTCATCAGAGACTGACTGCTGCTCTTGTG
CTCAGACATCCTTGGATCGTCCACTGGGACCAACTGCCACAATACCAACTAAACAGACAG
GATGCACCACATCTAGTAAAG
gtgagcagccccatacagtcactgttttccacaggtcctccaggagagacttcaagaagc
cctgtccatgcccccagcacctttctctttcatcctgcatccagttctgttgtgggattc
tcttacagtgggtgacttcgaaaagctcaaggcatatcaatatattagtaataaaactag
EXON 22  159 bp
cctccatgttggcctctacagttttggttaagtcagtggatttgaccagtgtggttattt
tcattatgaaccaaataaaatctatgtacatttgcatatgaaaaaactcttcattttgta
tttgtgtacgtgtgactatccattgtcacttttgttactacctttatttcctttgttcag
GGTGCCATGGCAGCTACATATTCTGCTTTGAACCGTAATCAGTCACCAGTTTTGGAACCA
GTAGGCCGCTCTACTCTTGCTCAGCGGAGAGGTATTAAAAAAATCACCTCAACAGCCCTG
TGAAGTGACCTCAGTGAGATATTTGGTACCATGGTGTAA
gctgatagcacaagttctggcgacaggtagcacgtatctgagagacacctgcaagcacac
actgtcccagctggtacccataatgctgctgttcctgctgctgctcctgctttcctctct
tctcgctttaaatgattgttagcaagttagattttcctggagcttcggaagaaatgaaaa