Gene RBM3 Variant 1
DNA : 3.76 KbNT_011568
mRNA : 1379 bp NM_006743
CDS : 474 bp NP_006734
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  50 bp
tttcgcggagaacactgctcccttcgctttgctgtcccttcctctccccaccactccgct
cctgctggcctcagccaatcagcacgcacgccgggacgcgcaaggggaacgttccgggac
gttctcgctacgtactctttatcaatcgtcttccggcgcagccccgtccctgttttttgt
GCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATTTCCAG
gtaagttgcatatgtcctgcgaaacggcggctcctcgccacacacgcgccgcgccggccg
tgaccggggaatagcgagtggggagagtaatggccactgacacgtaggcttggctttctc
tgggacgggcgggtcccgtgcttggaggtgaaacatttcggttggtgggaggccggcgcg
EXON 2  116 bp
gccagctcctcagattaccaccttattggccgcctttctcagcttttctgtagttaccca
tattttgttcctctttcttgtctattttctgtgctttttctctgctttccgtctcgctat
tttctcacatctccattttctttctccttcctgccaccattcttcatgttcttcccacag
GACTTGAACTGCCATGTCCTCTGAAGAAGGAAAGCTCTTCGTGGGAGGGCTCAACTTTAA
CACCGACGAGCAGGCACTGGAAGACCACTTCAGCAGTTTCGGACCTATCTCTGAGG
gtgagacgggccatactcacaatgggggttggtgagagaaagtctgggatccttgcattt
caaggagtattaactgaaaagttaggacccacgcctccaaattctttttcttcctaagcc
tatggtgtagactaaggatgaggggaagcgtctttgggattagtgggagcgctccgtttt
EXON 3  107 bp
caaattctttttcttcctaagcctatggtgtagactaaggatgaggggaagcgtctttgg
gattagtgggagcgctccgttttccctacctatgccatctccttttccggccaccctttg
ctacttaacctttggggtactgactggtccacattgctccatcttctctccctctcacag
TGGTCGTTGTCAAGGACCGGGAGACTCAGCGGTCCAGGGGTTTTGGTTTCATCACCTTCA
CCAACCCAGAGCATGCTTCAGTTGCCATGAGAGCCATGAACGGAGAG
gtggggcctcctatctgcagagggaccttgtccccatctgcggcttccttcattcttttt
gtttttccctctgtgtctgctcggggcagcgtggccaccaagccccgcagtgcccactca
caggagcatgactgccttttgttctagggggtggagggcagcggcagacagagcctggcc
EXON 4  106 bp
ttctatagctcctgatgaagccattctggggtaaaggagcttattctggaacatggcacc
cagaacctggtgcccagcaggaatttttggcctcttttgcccacttacccttgcctgctc
ttccctcaccattgccctgactgactgccaacccatcatccttgtgtctcccacacttag
TCTCTGGATGGTCGTCAGATCCGTGTGGATCATGCAGGCAAGTCTGCTCGGGGAACCAGA
GGAGGTGGCTTTGGGGCCCATGGGCGTGGTCGCAGCTACTCTAGAG
gtgagtgcagtgatcgttttgatcatggggtgagagggagagttgcctatgtgtggacaa
ctgccatttaaatatttttctgctctaggtggtggggaccagggctatgggagtggcagg
tattatgacagtcgacctggagggtatggatatggatatggacgttccagagactataat
EXON 5  97 bp
tcagatccgtgtggatcatgcaggcaagtctgctcggggaaccagaggaggtggctttgg
ggcccatgggcgtggtcgcagctactctagaggtgagtgcagtgatcgttttgatcatgg
ggtgagagggagagttgcctatgtgtggacaactgccatttaaatatttttctgctctag
GTGGTGGGGACCAGGGCTATGGGAGTGGCAGGTATTATGACAGTCGACCTGGAGGGTATG
GATATGGATATGGACGTTCCAGAGACTATAATGGCAG
gtgggtagccaaagggctgggatgttctcctattgcttccctctccttaagaactcagcg
cctgggtgttcatgcataccacaccttgctgttactaatgtgtacctaaaatgagtatga
aatttagcattttaagttaattgtgtagtcatatagttgcgacatggtaaagtatactat
EXON 6  84 bp
actgcgtataaatcgtatgccataaaactgtttactgtgatactcatatgcttaacatat
cctgtttttgatacgtaaggtttatgttatgacccatactgtaaaatgtgacgcatataa
ttacagtggtatatataatgcagtaccagaaaacttttgtgtgttttttttcccccccag
AAACCAGGGTGGTTATGACCGCTACTCAGGAGGAAATTACAGAGACAATTATGACAACTG
AAATGAGACATGCACATAATATAG
gtgagacttggatatcggcattgagtgaacctgtttgtcacactctgtcatgaccctctc
accttttctggcaagactgctctgcatttctgctgccctcatacctcacccagccaacct
accaaacattcctagctaggccttccttgctctcaggtgcatatcagagcaagtttgcta
EXON 7  819 bp
tgctagggggtgggatctgaaaacccatctcctataatcttctactcttgtgtgggatgg
aggaaatgaaggtgtgtccctgttgtccaaccctcagcatcttcatcagctctaggaggt
gagcatgttgtcagctgttacttcatgacatcacaattctccccctcttgctgttcccag
ATACACAAGGAATAATTTCTGATCCAGGATCGTCCTTCCAAATGGCTGTATTTATAAAGG
TTTTTGGAGCTGCACCGAAGCATCTTATTTTATAGTATATCAACCTTTTGTTTTTAAATT
GACCTGCCAAGGTAGCTGAAGACCTTTTAGACAGTTCCATCTTTTTTTTTAAATTTTTTC
TGCCTATTTAAAGACAAATTATGGGACGTTTGTAGAACCTGAGTATTTTTCTTTTTACCA
GTTTTTTAGTTTGAGCTCTTAGGTTTATTGGAGCTAGCAATAATTGGTTCTGGCAAGTTT
GGCCAGACTGACTTCAAAAAATTAATGTGTATCCAGGGACATTTTAAAAACCTGTACACA
GTGTTTATTGTGGTTAGGAAGCAATTTCCCAATGTACCTATAAGAAATGTGCATCAAGCC
AGCCTGACCAACATGGTGAAACCCCATCTGTACTAAACATAAAAAAATTAGCCTGGCATG
GTGGTGTACGCCTGTAATCCCAGTGACTTGGGAGGCTGAGGCAGGAGAATCGCTTGAACC
CGGGAGGCGGAGGTTGCAGTGAGCTAAGATCGCGCCACTGTACTCCAGCCTGGGCAACAG
CGAGACTCCATCTCAAAAAAAAAGGAAATGTGTATCAAGAACATGATTATCCAGCGGTAT
TTTCTAATTCAGATCATCAAACTGATTATATAGAAGAGTTGGCTTTAAAATGTTTGCAAA
TGTCTTTTTTTTTTTAATACTGGAAGAAAAAATATTCTGTTGTGTCTCATACAGTGCTTA
GGATGTCTTTCACAGAGCTTATTAAAAAGATGAAACCTG
agaacaaactgctttattcttactcagcccattttgcaaattaaaagtgggggcagaggt
gggcggatcacctgaggtcaggagttcgagaccagcctggccaacagggcaaaaccccat
ctctactaaaaatacaaaagttagcggggcgtggtggcgggtgcatgtaatcccagctac