Gene RBBP7 Variant 1
DNA : 25.68 KbNT_011757
mRNA : 1940 bp NM_002893
CDS : 1278 bp NP_002884
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  297 bp
tcgcgcctgcgcatcgccaacttcctgccgcggcacgctccgcccacccccagaagcccg
cctccgaacgccgcgtgaaacccgcccgccgcgcgtcattggtctcggcgccggagccgt
tggctcccagacccgcctctccgcctcctctcacttttcccagggcggatgcgcctgcgc
TCAGCTGCCTGGGCGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAG
AGAGAGAAGAGCGCCTCAGACCTCGGTACCCGCGAGCGGGGAGGAGGCAGGAAAGAAGGA
CGCGGCGTCTGGGGAGCACCCAGGCAGCAAGACGGGGCCCGGGCTTTCGACAGTGGGGAG
TGTGACGCGCTTGGGAAAGGCAGGAGCGCCAGCGGTCGGGCTGCTCTTGGCTAACGAGAG
GAGTCCGAGGCGGCGGCGAGGGGCGAACGACCCGACGCAAGATGGCGAGTAAAGAGA
gtaagaggccctgcggggcggcgcgcgccggggccgcggggggcggcgggcgcgcgaggc
cgcggcacgcgccggcgaaaggcgcgaattggcgtgcggagcagggggcggggccgggcg
cgagactgggcgcgcgcctcgaggggcctgcgcgggacgggaccgccgcgccgagggctc
EXON 2  145 bp
aaataggcttcctgattgttagtattttctccaccttctggaagagcagttagttgtccg
tgtccaaattagaggtaaaaggaaagagtacatgaggtgtggccatcttgaggtgacctc
caatttctgactttgatctatctcagccacttaatcgtgtgggctttctccaaatttcag
TGTTTGAAGATACTGTGGAGGAGCGTGTCATCAATGAAGAATATAAAATCTGGAAGAAGA
ATACACCGTTTCTATATGACCTGGTTATGACCCATGCTCTTCAGTGGCCCAGTCTTACCG
TTCAGTGGCTTCCTGAAGTGACTAA
gtaagggtttctggcaacttttattttgtttaaatttaactgtcgttctgaatttcctag
ttttggcgttttatgcatagaacataagtatgtaatcagcccttgcatgaggtggcaggt
ggtttttattttcaaaacttacgtgatttgtgggatgatttctggtgtatagtgtggtgg
EXON 3  146 bp
ttatatttgcatatgtggggattgtaaagttggtaaccagagggggagaagatacacagt
tgatgctaagtatatatttgctaaagaaatatgaatgtattttgagggaactagactgaa
tttgttagcaattggagatttcttgtaggattagtgtgacttattttctttcttaaacag
ACCTGAAGGAAAAGATTATGCCCTTCATTGGCTAGTGCTGGGGACTCATACGTCTGATGA
GCAGAATCATCTGGTGGTTGCTCGAGTACATATTCCCAATGATGATGCACAGTTTGATGC
TTCCCATTGTGACAGTGACAAGGGTG
gtaggtatatcatatattccaatattggtgtcaaagggaaaatgtctctttcaaagcata
tgctattaaaactatactattagcttttggcccagtaatttaacttctaggactttattc
tacagaacttcccacccacatgtgcacaaggattttagtcgtaattgcagaattgaaaaa
EXON 4  174 bp
ataaattgatgtggcaaatgaacccacatttttgggttttctctatgcatgtttctgtct
ttgtcttgtcagtttgtgttgtattctgccaggtcaaaatctgttaggttgattgaacta
agtgatttgtgaattttaatcctgagtgtgtgtgtgtgtgtttctttctcctcacattag
AATTTGGTGGCTTTGGTTCTGTAACAGGAAAAATTGAATGTGAAATTAAAATCAATCACG
AAGGAGAAGTAAACCGTGCTCGTTACATGCCGCAGAATCCTCACATCATTGCTACAAAAA
CACCATCTTCTGATGTGTTGGTTTTTGACTATACAAAACACCCTGCTAAACCAG
gtatgtaataatagagttaggtcattacttgagcagttttcttgattcaaactggtaatg
tttttaaggtcaaagtagcatactttataatatttaaaggtttaaaaattgctttggggg
tcccataaccatcctcaagttcagggatttgccagaactacctaaaagcagcttatacta
EXON 5  116 bp
taggttttccaaagaaaccaatcatctaatggtcatgaggctcaatttgcattgggtatt
aaagaccagatctcgttcgtgtgcagttgctgtaatggttcactcaatgaaggagtgaga
atttattctcaccagttctgataaacagagaataacttaatgtttttcatcttttcttag
ACCCAAGTGGAGAATGTAATCCTGATCTCAGATTAAGAGGTCACCAGAAGGAAGGCTATG
GTCTCTCCTGGAATTCAAATTTGAGTGGACATCTCCTAAGTGCATCTGATGACCAT
gtgagaaacgtattctttgtaatttgttcatatagtgagagctgacgtgtcacagctgtg
ctgaaggagtactatatagatgaaaggttttctaagataatactgctgattattgtggta
acattcccccaggactttagagagatggttttcatactgccctgtatgagtcttcggatt
EXON 6  161 bp
ctgtaatcccagctcaggaggctgaggcaggagaatcgcttgagccctggaggcggaggc
tgcagtgagccgagatcgcaccagcctgggtgacagactgagacactgtctcgagggaaa
aaaaaaaaaatcagtctcttatagcccttgttcttttttttttctctccttctctcttag
ACTGTTTGTCTGTGGGATATAAACGCAGGACCAAAAGAAGGCAAAATTGTGGATGCTAAA
GCCATCTTTACTGGCCACTCAGCTGTTGTAGAGGATGTGGCCTGGCACCTGCTGCACGAG
TCATTGTTTGGATCTGTTGCTGATGATCAGAAACTTATGAT
gtaaggtggaaaattcagtgggatcttgttaaatgggtgacctgaatgaccatcagtgat
tgctgcaggctgtagtttgattttttttttttaagttatggctttaaaaaacagctttag
gtagcttactcctgtaatctcaataccttgggaagctgaggcaggaggattgcttgagac
EXON 7  127 bp
ctctgtaggtttcgaatgtatcatttagtggtcgaggtctgaatcaccagctgtgtggtt
ggtttcttcatgaaggggagcacatagtggagctagttgtggagtgcagtgacagtgatg
tgaggccgaatgtgagtgtgtcatccctgggtgccgtgtgcctttacctttgtgttttag
ATGGGACACCAGGTCCAATACCACCTCCAAGCCGAGTCACTTGGTGGATGCGCACACTGC
CGAAGTCAACTGCCTCTCATTCAATCCCTACAGCGAATTTATTCTAGCCACCGGCTCTGC
GGATAAG
gtttcgaagtttttgcattatttggtgtttataaaacccagttctcttgtgccttaatca
gatatttgaaaattcttaggtaaagcatagaaatcattttcacttgttatttttctttag
accgtagctttatgggatctgcgtaacttaaaattaaaactccataccttcgaatctcat
EXON 8  78 bp
aactgcctctcattcaatccctacagcgaatttattctagccaccggctctgcggataag
gtttcgaagtttttgcattatttggtgtttataaaacccagttctcttgtgccttaatca
gatatttgaaaattcttaggtaaagcatagaaatcattttcacttgttatttttctttag
ACCGTAGCTTTATGGGATCTGCGTAACTTAAAATTAAAACTCCATACCTTCGAATCTCAT
AAAGATGAAATTTTCCAG
gtatgtgacagttttctggtgtctgtatgtcaggaaatgaaatccagggattcatcagtt
aagctataccagactcgtgggtccactattgaaaaaaatgtcttgtacgtggtgttacat
ggagatgctcatagggtaaggtacaccttgttgaagaattaaaaagcttctgggatggtt
EXON 9  77 bp
aggacaggatggagctgagcccttgcagagcacttgaaagtcggggacaagagagtgagg
ccatcaggccaaggataagataatagagtgcaagatgggaaaatatcagattagaacaac
agccacaaacctagcagcggatgattctttaaatacattttcaaaattatctattactag
GTCCACTGGTCTCCACATAATGAAACTATTCTGGCTTCAAGTGGTACTGACCGCCGCCTG
AATGTGTGGGATTTAAG
gtaacttacagtcctgtgacaagatactgcataaatgtgcctatctggcaagttacatag
tcattcataaactagaaaagcaatttggtaatccccccttcaagaaacctaatattaaag
aaacttctaagcatcttcctaaagagcctttgttctgtaaaatagaagtgaagcagcaaa
EXON 10  58 bp
aacatagcgaggccatgtctctaaggaaaaaaaaaacctaattgattgtagtatagaaat
aagttgtttttgtgagtgtgtttatgttttaagattactttctgggctgatactggttta
gcagatgttcgtgctacaagaatttcactgatgaaagcgttatattctttattcttacag
TAAAATTGGGGAAGAACAATCAGCAGAAGATGCAGAAGATGGGCCTCCAGAACTCCTG
gtacgcattggcttatagaagatgaaatgtcatatgcagattggattgtcattgatctct
ttatttcgagaatgggtcagaacttcgaattctagctcttgcagatggtttcaaaatgga
ggccctgaaggttattgcaactgggctttgacatttatcaaaaatagtaaatggagccca
EXON 11  111 bp
ctggaggtttggaaatttgcaaaataagtataaatagattactgagcctgtaccaccttc
taaaaccagacagcacccacccccagttgaaatactgatagctctaaaaacttagtaaaa
cctttgttaggattaacaggagagtatatgaaatcaaagctttttttgttcttgtaacag
TTTATTCATGGAGGACACACTGCTAAGATTTCAGATTTTAGCTGGAACCCCAATGAGCCT
TGGGTCATTTGCTCAGTGTCTGAGGATAACATCATGCAGATATGGCAAATG
gtgagttaaaatgtttttcttgaatgactgtcttgtaaaggagagatttactacttacat
aatgtaataaagttatttcgaatatgtaggtgcatattatgccaaacatttacagaaacc
gtttaaaagaactttttccatttcaacaatacaatctttagtcccatatggtgcttcgtc
EXON 12  450 bp
attacacactggcaaagaatttttcaaaatactggctagcctaccatttccttattgaag
tttttaagagagaaatgtaaaaatgaaactattaagttctaaatagattaaattgttttt
acatgaccatgtgaaaaccatagggagtttttacctgtgaatttatttggttatctccag
GCTGAAAATATTTACAATGATGAAGAGTCAGATGTCACGACATCCGAACTGGAGGGACAA
GGATCTTAAACCCAAAGTACGAGAAATGTTTCTGTTGAATGTAATGCTACATGAATGCTT
GATTTATCAAGCGCCAAAAAGGCATTGTATAGTAGGAAATGTAAGTGGGGTGGCTTATGG
CTTCTTTATCCTCTGATTCTAGCACTTTCAAGTGAGCTGTTGCGTACTGTATCATATTGT
AGCTATTAGGGAAGAGAAGAATGTTGCTTAAGAAAGAACATCACCATTGATTTTAAATAC
AAGTAGCAGGGTATTGCCTTTGATTCAACTGTTTTAAGTCCTCATTTTCTCAAACTAAGT
GCTTGCTGTTCCCAAATATGCAAGAATAACTTTTACACTTTTTCCTTCCAACACTTCTTG
ATTGGCTTTGCAGAAATAAAGTTTTAAAAT
aaaacttgtgtttttttaaaagcttagtgggggggggcgggggagtctactttttgagta
gaaatgggtaaaatggtacctttggactcctacagttaaggtcacatggataatgaaaga
atacacagaagctgttaagtttatcatacatatttacttaatctatacagaatcaagtag