Gene PQBP1 Variant 1
DNA : 4.88 KbNT_011568
mRNA : 1113 bp NM_005710
CDS : 798 bp NP_005701
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  324 bp
gagtgtattggtaacgttggggtgggtgcactcttttggagctggaggaagtgctgccct
ctgctcccccatcccagcgctttggtttctcccacccggcagtcatggggacgctggatg
agcccatttctgaagtgcggaggggccgggcttcttaggctgtgggcggagcctgggcct
GGGAGAGGAACAGGGCCCTGGAGCACCTGGTTTCGGGGACAGTAGGGTTGGTGGGAGTTG
CGATGATATTGCCACCTACCTCTTACATCTTTTAGTGCGTATGTTCTGTCCACCCAGCTA
CTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTA
CGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGG
TCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAG
GCATCCTCAAACATCTGGAGCCTG
gtgagacagctaaaagcagatggtcctaacacgtgccagcctcgacaggcacttttgttg
ttgatactgacgcttgatacctagcatgggccaactgtgcaccaagcaatggggtggcag
gcatttttcgttgttaacaatgtggattcctgacatccatccctaccgcgtgtcaagtgg
EXON 2  112 bp
cctaatatagagagttggatttggaatgtgaaagatacttcatattcttcccggcacaca
cacacacgtgtcttttatgtgtggcttgtgtgaatgtgagtgcgtgtctctaggctctac
atgtaggatgaggtcccctggtccttatctgctctcctcatccccaccttgttctaccag
AACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTACGAGGCCA
CCAGGTTGGAGGGCCTACCACCAAGCTGGTACAAGGTGTTCGACCCTTCCTG
gtgagcctgggtgagggggagctaacttctggcttcacccttcctgtgctgaccttggtt
gtgaggtttagggggacacaagggagggagcctcgggtggagggtgttggcattaggtat
ctgcaggactcaagttgctgcctgctggggcctggctcctctggggttggaagactgtct
EXON 3  113 bp
attacaggcatgagccaccacgcccagctgacagtgttttctcttcaggagaagagattc
tggggatcctgcctgtggggtcctgacatggggcaggtataggcagagactggggagaca
agagttgaggatccaaggcaaggacatctgtgctgacacttctttcctgcggccccacag
CGGGCTCCCTTACTACTGGAATGCAGACACAGACCTTGTATCCTGGCTCTCCCCACATGA
CCCCAACTCCGTGGTTACCAAATCGGCCAAGAAGCTCAGAAGCAGTAATGCAG
gtgagttggcaggtacaagcgtgccttgagtgatcttagcagttctcacggagaggccaa
gtagaatgatagtggatcagaggggcaggtgagaccaggcgggcccagcctcaggcaagg
gaggttgttgaaggcagaggctgctgggtcctggggtggcaagaggtcacttcaagactt
EXON 4  285 bp
aggtacaagcgtgccttgagtgatcttagcagttctcacggagaggccaagtagaatgat
agtggatcagaggggcaggtgagaccaggcgggcccagcctcaggcaagggaggttgttg
aaggcagaggctgctgggtcctggggtggcaagaggtcacttcaagacttgtgtccccag
ATGCTGAAGAAAAGTTGGACCGGAGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGG
ACCGCAGCCATGAGAAACTAGACAGGGGCCACGACAAGTCAGACCGGGGCCACGACAAGT
CTGACAGGGATCGAGAGCGTGGCTATGACAAGGTAGACAGAGAGAGAGAGCGAGACAGGG
AACGGGATCGGGACCGCGGGTATGACAAGGCAGACCGGGAAGAGGGCAAAGAACGGCGCC
ACCATCGCCGGGAGGAGCTGGCTCCCTATCCCAAGAGCAAGAAGG
gtaagctgggcagaatggggctcggtgagaccaacaaggtgcagggtgcactgcgtgagg
aagccttccctcaaaaagatgcctggacctggggctagaggagggtgctgtggtacatgg
cagccaggggcttcatttcttcttgtggggtggggctcagtgatcaggggctcctggtgc
EXON 5  64 bp
caaggtgcagggtgcactgcgtgaggaagccttccctcaaaaagatgcctggacctgggg
ctagaggagggtgctgtggtacatggcagccaggggcttcatttcttcttgtggggtggg
gctcagtgatcaggggctcctggtgcctctattgaagactttgccctgccacttccacag
CAGTAAGCCGAAAGGATGAAGAGTTAGACCCCATGGACCCTAGCTCATACTCAGACGCCC
CCCG
gtaagtgacaacccctcttgactcagtacgtggacaccatcctccggcctccttcctcca
ttcctcattgggaccaggtgggctgtgtccgccacatcacccatccccatcccctgactc
tttcaccggcaggggcacgtggtcaacaggactccccaagcggaatgaggccaagactgg
EXON 6  215 bp
tgaagagttagaccccatggaccctagctcatactcagacgccccccggtaagtgacaac
ccctcttgactcagtacgtggacaccatcctccggcctccttcctccattcctcattggg
accaggtgggctgtgtccgccacatcacccatccccatcccctgactctttcaccggcag
GGGCACGTGGTCAACAGGACTCCCCAAGCGGAATGAGGCCAAGACTGGCGCTGACACCAC
AGCAGCTGGGCCCCTCTTCCAGCAGCGGCCGTATCCATCCCCAGGGGCTGTGCTCCGGGC
CAATGCAGAGGCCTCCCGAACCAAGCAGCAGGATTGAAGCTTCGGCCTCCCTGGCCCTGG
GTTAAAATAAAAGCTTTCTGGTGATCCTGCCCACC
atacctgagtgcttcctttgaggctgcccaacccaagtcggcaagatacacaacacattt
tatttgcaaaaactcagctaagagatagtgtggagctggcaggggctggggggctgagct
gaggtgggtcatgagagagcttagtcatgttggccctgggtggggcaggggtggtgggga