Gene PIGA Variant 1
DNA : 16.07 KbNT_011757
mRNA : 2930 bp NM_020473
CDS : 3222 bp NP_065206
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  23 bp
gcgctgacgttacatctcgcgcttaagggtggggacgacagagcgtctctctcggacgtg
acctcagcgcctctttgtgattggctgcctcgggggcgcggcccttgggcgcggacgccc
tagattggtgctgcggaacagcagggagggactccggctgcagccgcgggaggtccggac
ACTGGCGGCCATGGAACTCACCG
gtgagtgcgcgtcgcgccgcccctctccagcgctctgggccgctttcggatggggctgtt
ctgcgcgcgtgggatcgtggcgggtggtggagggggtgaaaccgacccggttcgaagccc
ggaagttgggtcggagggtctccagagtaggttggggctgagggtgcgtttagggcggac
EXON 2  119 bp
ttgttgtatgtaaatgccaagcaagtaaatgtcaaatgagtaaattgatgatttgcttta
tttttaattctggggaaagctaacaaatttacattaacattaaaacaatatctatatctg
gatttgtaatatggaatgtgttttgtttctgagctgagatcctgttttactctttttcag
GTAATAGAGGACACATCTCTTAACTGGGTTGCTCTAAGAACTGATGTCTAAACCGTCTCA
GCATGGCCTGTAGAGGAGGAGCTGGGAATGGCCACCGTGCCTCAGCTACACTCTCTCGG
gttagccctggaagtctttacacatgtagaacccgtacccataatatatgcatggtatct
gactttttctacccaaatatgggaggcgtggaaagccacatttaccagctctctcagtgc
ctgattgaaagagggcataaggttataattgtcacccatgcttatggaaatcgaaaaggc
EXON 3  133 bp
tcttgggggaccactgccagtttgcaaacaattccactcctggaaaaggtttaagagagt
ttctctcctttatggagtgcatagctaatacttttcaaaataagtggattctcagtcgtt
ctggtgaatttttttaagtttaaatattaatatctccaacattcaactttatattttcag
GGATCGATTTGCTTAGTGGTATAATACCTGAACTCTGTCAGAAATATCCAGATTTAAATT
TCATAATTGGAGGAGAGGGACCAAAGAGAATCATTTTGGAAGAAGTTCGGGAAAGATACC
AGCTGCATGACAG
gtattgatgaatttcatgttgtcttgagggagaagatgtcaattatctctatttggtttt
aactgcatgcgtaccttaggtgtgttgcttctcctgcatgtaattgatatacatataatt
gatataaatctaatgcaaggactgttttcaaaatttttatataaataggaaacctagtta
EXON 4  133 bp
aactgctttataaggctgtttctattagatcagtgtttggtgatactaatcttgaggtgg
agaacattagcagcaataagaatttaagtgtaatataaatagcagacttggtttataaat
taaatttcttttgtagcatgagttttcactcctttcttcccctctcatttaaaaaatcag
GGTGCGTCTTTTGGGAGCTTTAGAACACAAGGATGTTAGAAATGTCTTAGTTCAAGGACA
TATTTTTCTGAATACCTCCCTTACTGAAGCATTCTGCATGGCGATCGTGGAAGCAGCCAG
TTGTGGTTTACAG
gtaaaaagctttgagggcattcatggttgggatttctgtgtattttgaaaaataatgaga
cacattccataataatgttttaactggttttgttgatcttcctgaggtatgattatggtg
gagtatgtgttctttctttctttttaaggttgtaagtaccagagttggtggaattcctga
EXON 5  207 bp
cgatcgtggaagcagccagttgtggtttacaggtaaaaagctttgagggcattcatggtt
gggatttctgtgtattttgaaaaataatgagacacattccataataatgttttaactggt
tttgttgatcttcctgaggtatgattatggtggagtatgtgttctttctttctttttaag
GTTGTAAGTACCAGAGTTGGTGGAATTCCTGAGGTGCTTCCAGAAAACCTTATTATTTTA
TGTGAGCCTTCAGTAAAATCTTTGTGTGAAGGATTGGAAAAGGCTATTTTCCAACTGAAG
TCAGGGACATTGCCAGCTCCAGAAAACATCCATAACATAGTAAAGACTTTCTACACCTGG
AGGAATGTTGCAGAAAGAACTGAAAAG
gtatgtcacatgctgagaaaagattgtgtctgaactcttacttgatgtttcacgtacaca
tttgctttttcttacatagatgtttaccatttttgttctattgcttaagttgatgaaatc
tcttccaggtgaaaagaaacagattttggtacacacaccgggctaagtgtctggtcaaat
EXON 6  2315 bp
ataattatcgtgattaagttcattaaggatatcattactatgacaacaacaacaaaacac
aagcaacttttgtttgtatttgtttataaaatgttcctgcaggatcgggtcattgtttat
catgggacaggtgatggggtgatgggtgaaagtgctcacacttggcttctctccctccag
GTATATGACCGGGTATCAGTGGAAGCTGTGTTGCCAATGGACAAACGACTGGACAGACTT
ATTTCTCACTGCGGCCCAGTAACAGGCTACATCTTTGCTTTGTTGGCAGTTTTCAACTTC
CTCTTCCTCATTTTCTTGAGATGGATGACTCCAGATTCTATCATTGATGTTGCAATAGAT
GCCACTGGGCCACGGGGTGCCTGGACTAATAACTATTCTCACAGTAAAAGAGGGGGTGAG
AATAATGAGATATCTGAAACCAGGTAGAAGGAAGCCTAGATTGTAAGATTTTAAACATTT
GTAATAGTTCTATAAAGACTATGGAAAATAACCTTGCTTTTGGGGGGTTTTTGTTTTTTT
AGAGTTAATTTAGTAAGTTATGCTACCTCTATATCATTCAATATTTTCTGTTGAGGAAAG
ATAAAAATGTATGCAATTCCTGAGTGTAGAAACTTCTTGCACTTATTTAAAATTTAGGAG
AGAACATTTAAGCCACTCAGGTATGCAATTTTTCAGACTACTGAAATCCCTGTAGCAGAG
ATGTTTTAACATTATATTTTGAGAGCTTTGGGTGCTGAAGGGCCAAACGTTTTCTGGGCA
TTTTTTGGCCAGTTTTTAATGTAACACCATTAGACACTCACCAGATGTTTACAAGTTTTC
TTTAGGGGAACTACAACAATTATATGAACTGTTTTATATCATGTTCATATACATTTATTA
GGAATCTAAATCATGTCTTTGAACATTTATTAGGTTCACTCAGTAGGTGTTACATGTAAT
TAACAGGTTCCTTGAGTAAGATAGTCCATCAGTTACCAGCACATTTTGAACCCCTGCTCT
GTGTAGAATGTTGAACTAGATGCTTCCCGCCATTAAGGACCAGGGGTGCATTCACTCTTT
GTTTACCATTCAAATGGCTTACTTCATCATAATTGTGGTTGATATGAGATCAATATCCAA
CATGCCAAAAATGCTCATGCCAGTTAATGCCAGGAAAAAAATCACCGACACACTACTAGT
ACTTTGTTCCTGTTGTATGCATTCTCCTAGGTAGAGCCTCCATCTTCAGTTGTGTTTGTG
AAGGTATTTTTTGCTTTTTAAATACTGGGGACCGATATCACTGTTGATAGTGCAGAGAAA
CCCTCCACATTTTTCAGTGCATAATTGAGTTTTCTATAAATGCCTTCGTGTTTTCTGAGC
AGAATGTACGAGGTGTGCCATCCCAAAACCAGCTGCTACCCTGTCCTTTTAATGTAAGTC
ACTCCCCTTCACTGTGGCCTCGCTGATGTCTGATAAGTATTGTCAGTGTGCAAAAGGCTT
TACTTCAGAATGGTTTATTTATAGCAAACTAAGTTGAAAATTTTAGAAACAGTCTTTGTG
GGTGGATGTTATTAACTGTCATTGTTGTTGCCCAGAGCCATGGGTTTTTTAACCCCAAAT
TATCCACATGGTGTGTATTATGAATTCTTTGAACTCTTAAGGTTTTTGTGAGAAAAGGAC
TGTGAATTCAAAACAATAAGGCACTTGTGGGTGCACTACATAGATTCTGACAGTGTTGTG
ATTCTGTATAGGATTTTTAAAAATGACAACATTCACAAAATTTATTACTTTTTAAAAAAT
AACATGCCTATTAACTGGTTGCACTGATATAAAAGAAATATATTTGTGTTTTGTTTGTAC
TAAAATGCAAAAGCAAGAGTGCAATTTTTAAAATCTAGAAGTTAGGGGTTTTGTTGGAGA
AAAATGGACTGATCTTTAAACTATTCAGTCTTACTGGGATTTTTATGCATAGAAACTCAC
ATATAAACATGAAATAAACAGTGCCAGTATTCATAGGAAAGTGAGAAACTGTAATATTTG
GCCATTATTCTATTCAACAGGTTTTAGAGGCATGCCACCATTTTTTCCTTATATTTTTGC
TTAATTTTTTTAAATTGTCATTTAATTCTTAAACTGTCATTTATTTGAGATGGAAATAAG
ATCTAAAGTTAGTTGCCTTTGCCTGTAAAACATGTGATTTGCAAATTATTATTTTTCTTT
TTTTTAACAAATGGAAGTAAATTTGTTTCACGTAAATCTTAATTTTCAACCTTTCTGGAT
ACCTTAATTGTAACTGTCAGTTTGCACTGGTCGGTATATGGAAACACATTGCTCTACCCT
GCTACTTAGTTGATTTTAAAGTGAATTTACAGTGATGAGAAATTTGTGAAAAATATATTG
TATTTCTTTTGATGTTTCAAAAGGTTGCCTATGAAAAACTGATTTGTTAAAACATGCTAC
ATGTCCAAAAATAAAGACCAGAATGACATTTTGAT
aattttctgagtttgtcttattttatgaacagactattatttactagtggaacaggctat
ccctgcccccgacacattctttttcagtgcaatttggatgtgttgcttggtctattagta
aaacaagaaataccctttgggcgatgaattactctgtcattttttgtttctagaatatct