Gene OPHN1 Variant 1
DNA : 390.93 KbNT_011669
mRNA : 7350 bp NM_002547
CDS : 2409 bp NP_002538
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  638 bp
ggaatgccgttctgggagagcagcctcccaggcggggtggtggggagactgcagggagga
gtcttggggagtgcaaacggaaagactacatctcccaggccgccacgctttccagctgga
gtcctagggcgctgactgctccccagtttccgtagggaagcgctgggctaccgcggctat
TGTGCGTCGCGCTCTCGCCCTCCTCTTCCCGCTGCAGTGTCTATGGAGCGAGGCTACGTT
TCATTGCCGCCCTGGCTTAACCCTTCCGGCGCCTAAAAGGACGGCCGGCCGGCCGGCTCC
CTTGCACCAGGAAGAAGTCTTAGCAGCCAGCGGGCCCTGGTCAGGAAACTCTAAGGTACA
AGGAAAACAGTTGAGGAAGGAGCCAGAGCGCTCCGGTTTGGTCCTCGGGCTTCGCTGGGG
CGGGGCGCAGGCGTTGGCTTTAAGAAAGGGGAGGGGACAGTGCAATCCGGGTTGCCCGCG
GAGTTCGGCCAAGGAAGTCTTCCGCTCGCTCCGGAGCGAGGAGCCTGTAGAGAGGCTGTT
CCCAGCTCCAGCTCTAACCTCGCCTACACCTTGGGCGGGCCCAAGTGTCACGTTTGCAAT
TGCTCAGGAAGGATCCGGCCCGTCTCCGGAGGCAAGTCGGGCTGCGGTTTTTGCTGCTTA
TCTGGGAAGGCGATGCCTAAGGGACATGCTGCTTGCTAGGCAGCACCCTGCCGGGATCCG
ACTGCGATAGTTAGCTCTCCCTGGCCCTGAAGCCATCGCCGGGGCGCCTGTTCTCTGTCC
GGACCAGCCAGCGCTCCTCAGGAGTCTCACTGAAACAG
gtacctgtcctccaaagggacggaggctatgagcttccttaagcgggtcgcgcgctcagt
ccgtcccctctacttcctctactgtgccattgatgctctcggtctttgtgtctttcccct
ttccccctactcccggccatcagaaccatgggtcatcccccgctggagttcagcgactgc
EXON 2  158 bp
gaccagccagcgctcctcaggagtctcactgaaacaggtacctgtcctccaaagggacgg
aggctatgagcttccttaagcgggtcgcgcgctcagtccgtcccctctacttcctctact
gtgccattgatgctctcggtctttgtgtctttcccctttccccctactcccggccatcag
AACCATGGGTCATCCCCCGCTGGAGTTCAGCGACTGCTACCTGGACAGCCCCGATTTCCG
CGAGAGGCTCAAGTGTTATGAGCAGGAACTGGAGAGGACCAACAAATTCATCAAAGACGT
AATCAAAGACGGCAACGCGCTTATCAGCGCTATGAGAA
gtaagtgcaaggcttcgatgagctgtttctctgagctggtgtgtctggcctttaagcctt
tccacaccaccaggggaagggagattgcagggtgactcccagcccagatctctgaggcaa
atgggtttcccacacttggggagtggagatagtagaagtggaaagtggtggatacaacca
EXON 3  96 bp
ttagttgttcaaactttcttctactgcatatctaatcttttgttttatttcattaaatgc
tagttgcaacctgctcagagcacttacctttggttttcttttatctgctcttatagagat
gaggaaatagatcaaagcatagcattgttgaacatttctcttgttacccttcctttgcag
ATTATTCTTCTGCTGTTCAGAAATTTTCCCAGACGCTGCAGTCATTTCAGTTTGATTTCA
TTGGAGACACTCTGACTGATGATGAAATTAACATCG
gtaagtcttcagctacatgtggtcatatacctgttgaggcagccctgagaccatgtagtc
tttttgatttgtggatacagagcacttggacatcttcatccactgtggtccaatgccaag
gccctgggaggttgattaggaaggatcaggaaactttccctgccagtcccatttcctcct
EXON 4  62 bp
aaagaaaagaaacattcaacaggtgctgaacacctgcttttgtcctccgatttgacacct
tcctctagtggccatgtgggcatagggcactggtccctacttcctgttgcacagatctct
atccatttgtctgtcaagcaccatgattaatttgttttacatttgattctctccttccag
CTGAATCCTTCAAGGAATTTGCTGAATTGCTCAACGAGGTAGAAAATGAGAGGATGATGA
TG
gtaagtcactaacgctgtcactgaagctgagttcatgggtgatataggggatttttcctt
tcctttatgcttggattgatcctatactattttgatttctgtcagatagcttcttggtgc
tataaaaatagttaggtaatagatctggttattatgtctcaagcttccaccctgagagtt
EXON 5  72 bp
ctcaatgcatttgatttttcagaaacaatatagaaacaaacagtaacaaaacccaacaaa
tcagcaaaccatttaacattttgcaggttggtatataaatgaaaatgtagtaacaaggaa
tcttgtatctgaaccttgttaacctagaaattgttttgtttgtttttcctttttgtctag
GTACACAATGCTAGTGATTTGCTGATTAAACCCTTGGAAAATTTCCGGAAGGAACAAATA
GGCTTCACCAAG
gtacattttctgtatatgcataagattttttaaaatagcaatcgaatagttgtatgggct
actattcttcactttacaaagatatgcaccaatctgctggtgctttgctcttggcctagt
cagcctcctaaactgtgcaaaataaatgtttgttgtttatgtcaccctgtctatggcatt
EXON 6  102 bp
ttcaggaagctgaaactgctgagaccaatacaaagttaattctccgttgcttttttttcc
ttccaggagctagagggattgaccacctgaaacctgacactatctccttcattctccttt
ctaagcagacagagttacaactacagacatttaatctttgcccttctttcccacctttag
GAGCGGAAAAAGAAATTTGAAAAGGATGGTGAGAGGTTTTATTCTTTACTGGATCGGCAC
TTACACCTGTCTTCAAAAAAGAAAGAATCTCAGTTACAAGAG
gtatgttcacaaagcctgcccctgccttccattgctagctatgccttagaaacagtgtga
attttgtactgcaaggcttttcccataccccgtctcagcagggaacctcatgtgatagta
gcacttgtagtcaaaactgtggcctgagactcagaagccctgaatactaagccagctctt
EXON 7  111 bp
atcctgtatcagtcacttttttatctcttggctttaggttctctatttctaaaataaaag
gtaacatcactagttggtggctaaatgctcatctagctctagcattctgttcaatcctta
agtactgactttcatgaatgaatatcccaatatgtaatgtttgttttccttcttctacag
GCAGACCTACAGGTGGACAAGGAGAGGCACAATTTTTTCGAGTCCTCTCTTGATTATGTT
TATCAAATCCAGGAAGTTCAGGAGTCCAAGAAGTTCAATATTGTGGAGCCT
gtaagttttctctgttgatgaatggtctaaaaatatttatcaaatgcctggtaaatgtac
aaactttgatcataaaaacagaatcccaaagaacgtgaaggataatcagtggaaatgtct
agaacgtagtctaacttacgtttttcttgttctttagtatactttttttctctctttccc
EXON 8  105 bp
ggctggtctcaaactcctgacctcacgatctgcccgcctcggcctcccaaagtgcaggga
ttacaggcataagccaccacacccagccacaccatggagttttttggtgagttcatgttt
cttttatttagtttattagaagatgctggtgataaagttatttttacatgttttccctag
GTCTTGGCCTTTCTTCATAGTCTGTTCATTTCTAACAGCCTGACTGTGGAGCTCACACAG
GATTTCCTCCCATACAAACAACAGCTCCAACTCAGTTTACAGAAT
gtgagtttgcatgtggatttttctcaccggtctttccattccgattgaatttcagcccta
gcgaccttgattcttggaattctaggttactgcatcctagccaatttgttagaatatact
ggtgtggatcacaaatatttagtatatcagactgttcttgctcttccactttcacatctt
EXON 9  130 bp
aggaccgttagactctataaacttgttttccattcactatgccattcaccatttcttttt
ttgctttgtggttgcacatgctgtaagcagggaaaactttgtactgagtctctgaccaag
aaatactttttcatgataatgatgatgataataatgattttcatgatgatgtcttgacag
ACAAGAAATCATTTCTCCAGTACCCGGGAAGAGATGGAAGAACTTAAGAAAAGGATGAAA
GAAGCTCCCCAGACATGCAAACTTCCAGGACAGCCAACTATTGAAGGCTATCTCTATACA
CAAGAGAAAT
gtgtgtggggacataggggtatccattgggtttcaataagccaggaactactgccacttg
tcggctgtgaattttgggcacccttactgttcatagacccctgatagctaaaattccctt
ggaacgcaggcagggaatactgaaaacaaaaaaaaaaaaaggagaaactgagaggaagtt
EXON 10  101 bp
tagaatctccctgtgtgcagtaggtaggtggctatggaaggagggcggtcagggcaaggg
cagggctggatctgaagtttgactctgaagagcaatgtgtaaatagcttccatcttaggg
ttgacttcctatacagctaaaatagttattctgtctgctcacttttacttgtccttgtag
GGGCTTTAGGAATATCCTGGGTGAAATACTATTGCCAGTATGAGAAAGAGACCAAAACAC
TGACCATGACGCCTATGGAGCAGAAGCCAGGTGCTAAGCAG
gtcagttcttgtttgcaccatatttttggaaatggatctatgactgtttctcagaaaaga
atatatgttgacctagtatcaaatcatcaagttcatcactgttacgtgaggccatgactt
tatatgtacaccttggcctaagtttgagtcagatagcactgagttgagtgaaaaatttct
EXON 11  92 bp
aaccatctgccatcttgctgcaaatactgtttgaagggacaagattctcagtgagtctac
acattgctcctgctgccttgaccagacgccttccaagtgacactgaagacactgtaggaa
gcagaaacagcttctgtgtctttttttaaaaattgcctgttaattcttgtttcatatcag
GGGCCCTTGGACTTAACACTGAAGTACTGTGTGAGAAGGAAGACGGAGTCTATCGACAAG
AGGTTCTGTTTTGACATAGAAACTAATGAAAG
gtaagctgtgccgctgtgaattggcaatgtccccacgtgccagatgcttagcctgggtag
gtcttttattttcctccgtcatcccacgttgatgacaatgagtaagtctattcaggactt
tgttgtgagtctattcaagccagctcttctggctgcccttcccagggatccctgctagac
EXON 12  79 bp
actgttctgtaaattgcctattgttttcttgagtaaaagagattttgaaaaattagtatt
ctgtaagcctatgcttgttcagtgtgacaaactccagggcagagagggaccctagatcac
aagactccattctctcagttgaattttctgctttatacttaccatttttttccccctcag
GCCAGGAACCATCACTCTGCAGGCCCTTTCAGAAGCTAACAGAAGGCTATGGATGGAAGC
CATGGATGGGAAAGAACCT
gtaagttacctgacactggggaaacctccccagcatatgccagtgtatgagtgccctcta
gtggtatcagtgggtctcagacaattaaatggtaatggattgtttagtctcagttttaga
gctgtaaggaattgtttccacatctcttagcaggtaaggcaactggagttccagaaaggt
EXON 13  34 bp
tattttctagcaatcttggcaaagcaattatgtttagcccacttggctatctttttaaca
tcctggagtttctaatcatttttaatgcctatctggggaaagatatttaatattatgttc
tctgttttcctatattgattgacaatagccatggatctttctgtttatcttcttttgtag
ATCTACCACAGCCCTATAACAAAACAGCAAGAAA
gtgagtcacttaagtttttggtctactagcattataaactgccagctgtccgattcatag
taaataccatcattaatgatgtgtactactaacgcaagtctgaatatggatgcctttgtg
tgaaataaaattcagccatatattttttaaatgtgtctggtaattgaactaaggtagaca
EXON 14  63 bp
ataagagttaaaatgttaaacctcccctgaaaaaatgactctttccatttaagggtgact
agaaatgagcaactaaaaacccttagctctctcaatgcagtccctttgcatggtcattaa
atgtttaataggtgacacctgttgcagcaggatctaactcttttcctttgcttgaaacag
TGGAGCTAAATGAAGTGGGCTTCAAGTTTGTCAGGAAGTGCATCAATATTATTGAGACCA
AAG
gtaagatctgaaccatagtcttggcattgtctgaatctcgtcactctgattttatcctgg
gcaatttctctgaagtagcgttttaggaatgaagactgtttataaagcttgtgtagtaga
tgcaagctagaaaatttcagaaaattctaaactagtggtatgcaagcatatttggataat
EXON 15  75 bp
aaatgaaaggatggataatttggagagatgctgtaggactattcccctgttacagggaag
gctggagaacttggagtatgtagtgtgaccccttcctatctgaattgaccctagtgtacc
aaggggagatgacaactctagctatacaagtgaaattaacctgattttttcctccactag
GGATCAAGACAGAAGGGTTGTACCGCACTGTGGGCAGCAATATTCAGGTTCAGAAGCTGC
TGAATGCCTTTTTTG
gtaacaattttactttgataattcttattgggagtactttatgtgttacaaagaaatgtg
actggaagagaaaggagacactgctaaaatgtggtagaatagttgaaaaaagtattttct
aaagtaaaacatacacatacttgcccaccctgggcagagtcaatcgtaccttgaaaatgg
EXON 16  85 bp
tcttatatggcagaccagaatgcagtcatgtttttgaaatatcaaagatttgcttcttct
aaagttttgatctcttaaaaactacttagggtaatatactttgtttttcttttaaaagag
ggaaaatgtaagatttttttgatgattaacttttgttttttgtttacttttctcaaatag
ATCCTAAATGCCCAGGAGATGTTGATTTTCATAATAGTGACTGGGACATTAAGACAATCA
CCAGCTCCTTGAAATTCTACCTCAG
gtatgcctgatttgaattgggagtttgcttttcatagctggtgaaatttctctgggtgtt
gagcggagttaacgtggtctcagttccaggagtttggatagaattgcttaagaaaaaaca
tgtgaagaggatttctggccaagaatgtgcaaagactgttttttaaatctgagagtttaa
EXON 17  59 bp
tcttttgttgaattactagcaacttggattccctgacgaagcttcaggtgaagagaaaaa
tgtatataatcccactaagctgtagggctcaggaacttcagccttgctgtccccagaact
aagaatccaatacccagctgctttcttcccaaagcaactgacaattttcattcatttcag
GAATCTTTCTGAACCTGTCATGACCTATAGACTTCACAAAGAGCTGGTCTCTGCTGCCA
gtaagtatttatgttactaattaactgtgttgtcctagtttcttaatgtttactgcaata
agcctagaaaattgtttgaggggaagtgattgagggcacagaaacctaaaacacatacac
aaattatgcacaactgccaaatgaaagtattcttgcttgctgtctaactcaagagttcta
EXON 18  106 bp
tatctctctctctgtgtgtgtctctgggtgtctttctccgaatctctctctgtgtgtgtg
tgtgtgtgtgtgtgtgtgcatgtgtgcatgtgtgtgtgtttgtgcatatatatgtgagaa
ttttgctcaatccagttgcccagaaagccaaaccatttatctcttactgttctatcccag
AGTCTGACAACCTGGATTACCGCCTAGGAGCTATTCACTCCCTGGTATATAAGCTACCAG
AAAAGAACCGAGAGATGCTGGAACTTCTGATAAGACACTTGGTCAA
gtaagtaactgctggattttcagaaaaagttcctattagaggactggcccatgtggttgg
actacacagaaactgcctctcagctctttcagccccagcccttaagtgcttccttggaag
ctgaatgctctgtgaggaaggctattttgccttgacccatgtacatatcctcttagagtc
EXON 19  160 bp
tactatcttgtattctttgctgattgtttcctttgtaatcttgccttccaatacatactt
taggtgctcctttccttctacattttagtttctcttaccctctacagcacctaaaacagt
cttggttgtaaggggatactggagcaaattttgttaatcttgccccttttcttctggcag
TGTGTGTGAGCACAGCAAAGAGAATCTTATGACCCCCTCCAACATGGGAGTAATCTTTGG
GCCCACCCTGATGAGAGCTCAGGAGGACACTGTGGCCGCCATGATGAACATCAAATTCCA
GAACATAGTGGTGGAAATACTAATCGAGCACTTTGGCAAG
gtatgcattttctattctcactacctgtcttccaaacatgtgacactttcccccaactgc
cttttagtgctgtgtcttcctccttggctcacgttgacagtgaaaggaaatcccattatg
acacaatgacatttaatggcaactctgaccctgggaaattcattcattcagcaaacattg
EXON 20  148 bp
atacctaaacatttacctgtagctagagtgattaagaaaatctctgattctttgagtcat
gttagtattcacgttacaaactctagatataaggccaacaagcatcaactggtgggtagc
attcagaagacaaaaacttgatctaattattctctagatatcttccttctttctccacag
ATCTATTTAGGTCCACCTGAGGAAAGCGCTGCACCGCCAGTGCCTCCGCCTCGGGTGACA
GCAAGAAGGCACAAACCAATCACGATTTCAAAGCGCTTGCTGCGAGAAAGGACGGTTTTC
TATACTTCTTCCCTGGATGAAAGCGAAG
gtcagtactgaggttcacctttagcttctgaatggtgattagacacaaagaggatatcga
agggcagaagcggtggcatgaccatttttctctctataaaagtagacctttcctggctcc
tgagcttaaaagcagccagggtttgtagtttgtgctcagagaggggattaagcctttgac
EXON 21  324 bp
ttacatgaactgggaagggtagagaatgattttgtgggatatagttggtttgtgccacag
tgacataactgctttgaaaatgtatacaaattttcaaaattaagtatgtatgcatgtatc
aaaatgaaaaggttttaaaagttatcattaatcttccctcttggcaccaacttttcctag
ATGAAATCCAACATCAAACACCGAATGGTACTATCACCAGCAGCATAGAACCCCCCAAGC
CACCACAACACCCCAAACTACCTATTCAGAGGAGTGGGGAAACTGATCCTGGGAGGAAGT
CCCCAAGCAGGCCTATTTTGGATGGCAAGTTGGAGCCCTGCCCAGAGGTGGACGTGGGGA
AGTTGGTGTCTAGGCTGCAGGATGGAGGGACCAAGATCACCCCAAAGGCCACCAATGGAC
CCATGCCAGGCTCTGGGCCCACCAAGACCCCCTCTTTCCACATAAAGAGACCAGCTCCCC
GGCCCCTGGCCCACCACAAGGAGG
gtaagtgcttgggaatcccatgggagccagagctgaccctaactacttttcaccttgaga
tccttctgagtttggagatatatttaagtggaaatatgttccagtttactaccactaata
ttggaacagtgggcaagatcacaataatcagtcacaataatcactagaatgtaagctcca
EXON 22  166 bp
tgaagggacagttgccagaaaaattacaaaaaaaaaaaaaaatagccagagttgttagtc
accaagaagaaatggaggccaaggaagttggcccaggtaactctcatattgggtgcctgc
tcatgagtagtgttctgtttggctaaccatccaagttcctggtatcattttctcttccag
GGGATGCTGACAGTTTCAGCAAAGTGCGGCCTCCAGGAGAAAAGCCAACCATCATCCGCC
CCCCAGTGAGGCCCCCAGATCCTCCCTGCCGGGCAGCTACTCCCCAAAAGCCAGAACCAA
AGCCAGATATTGTGGCTGGCAATGCGGGGGAAATCACATCATCTGT
gtaagtagggttgtacctcaaagttgactgaagtcctgtactaggccactaggaatgctt
tcaggatcaccatattaagggtatacagtgcacagccctggggcatccttcactttatag
tctagggaaatatcataggccagccctgttgggagtattccactcaatgctcaaagctga
EXON 23  51 bp
taggggtgcctatgggctctgggccatttcacatttgtatgtgtagggcctttgccagca
aaggcaggggctggcattggtgtcccatctggttcagagtctcctgtcctttctgttggc
cattggttctcacgtgtataccaaagcaacttatgggacttggttggcttctgtttgcag
GGTGGCTTCCAGGACCAGGTTTTTTGAAACAGCTTCCCGGAAAACAGGAAG
gtaagatatggaggtgacaaaagaaaaaccaaatcgccttttaataactgcatccttagc
atacaattgtgctcactctaacatctttctctttttgtttctctacagctctgtctctgt
ctgtcactttctcttccccaattctgtctctccatccctatctgtctgtcacctgttcac
EXON 24  42 bp
agagaaggagccccaactataagcatggagctaaatgttttgaaacatctgggctgaatc
acttctccatttttcaaatggcctctttagcactggcctagaagtgtcccccattccccc
aatttacctttccagtcctgatttctagaatcttagtgaaacgtctttctttatccacag
TTCTCAAGGCAGACTTCCTGGAGATGAAAGTTGAGGCTACAG
gtatgcagtccccatccctgattacaaaatcttgttccacataagccttcattacgggat
ctgatattttgaggactggaataacatgtagatcagaagggtgggaactcacttctacgc
ctcagttcattactctatcactgcctgacccttaaatttagtgactttcaattccaaggt
EXON 25  4291 bp
cttaggcctgtttcatgagatttgacttgtaagagcctttgcccagcaatccgctgttgc
tcagaagatgagctaccaattataggcttagctacctaccaagagaagccccactgatca
gtggctgttaagtacttgaccagtcctcgctaattccctactctcttctttctctttcag
GTTTTAAAAGCCTTGGCCTCAGAGGACCCTTTCCAGGTTCTGAAAGAGTCTTTCTTCTTC
AAACCTTTGTGTGCGGAGTCATTTTGTGTTGAAGAGCAGCTCCTTCCTAGCCTTGCACTT
TCAGACTCTCTCTGGGAGGCCATAAAATAAGGAGCATATGTCCTAGACAGGTGTTTATAT
CTCCTTTGTATTCTGTCTTCATCCCCTCAGAAGGTCTGTTTTGAGTTCCTATAACACTGT
GAAGAGCTGGACTCCCTCAAGCCAGACTCTGCCAAAACCAAGATATCCACTTACCTGAGT
TGAAGAGGGGAGCTCAGTTTTCAACTCTTCCCTGAACTTCCTGCTTCCTCAGAGGGCCAT
TGAACTCTGAGAGATTTGGGGCTAAAGACTGATCTCAGGGGTCTTACCTTGAACTGAAGG
CCACTTGAGTTGGGGCCATTGCTTACCTTGGTTGGAAGGGAATAGAAATGTTTGCTGAAC
ATTGGAGAATCTCAACATGTCTCCTACTGAGGATATGGACACTGGTGCCATGTCAGCGCT
CTGGTGCTGCAGTATGTTGCCAAGAGCCCGTCTGCTCCTGCGAGGCTATGAGTGGGATGA
GTGATGCCCCCACAGCACCTCCATGTGGACTTAGGAAGGTGGCCTTCCTGCTGTTACATG
CAGCCACTTAGGACAAATCTGCAAAGCATGTTTTGCATGTAAAAGCCTAGGTCTATTTGG
ATTATTCTTTCTCCTTTTTTTTGACAGCTTCCTGTCAAGCAATCAAGAAACAAACAAAAG
CTGAACACATTTCTTTTTAAAAAAAGGAGACTGTGTTTGGTCCTGTAGGAGTTCTATTTT
GGGGTCAAATGCTAGAAAAATTGTTAAGGTGGATTGAGGCCAGGCAGCTGTCACTGCTGC
TTCATGTTTGCCTTCTGCACATAAACTCTTTTATCTCCTGAAAAAAGCAGTTCTTAACCC
AGTGTCCATGGACTCAGAAACTCCATGATGCCCCTGAGATGGTATGCACAATTCCATGAC
AATATGCCCTTTCTGGGGAGATAGTCCATAATGTTCTGCTAAATTTCAAATGGGCTCGTG
ACCCAAAAAAGTCAAGAACCACAGCACTTGAGTAAAATACTCTTTTTACAATCCATATAA
GCCCTTGATTGGAAGGGCTTTTCAAAATCATTTAGTCTAACAACTGCCCAGTTTCCAGTC
GGGGGAACTGAGGCAGAGCAAGGTAGTGATCACACCAGTACAAGATCTCAGGTCCCAGGC
TCCTATGCAAGTTTTTTTTCCCCATTATATCACACTTATCTAGCAAGGGACCTTGTGGTT
TGTGGCTTTAGTGGCCATCATTTCTGGGGGTTGGCTTTTACCCTTTTTCTTGAATATTTG
CCACCAAGTGAAAAATGTTAGGACATAAACCCTTGCCAGGTCCCTTTCATTTGCTATCTC
TATTATTGGAAAGGACCTAAAAATTGGTGTAATGGGGCAGAAATCTGAGGAATGGACATT
TCTAATTCCTGTTTGTTGAAGGGAAGTTGCTGGAAAGAGCATCAGTACTTGTTTCTATGC
AGATGCCTGGGCCGTAGCTTGTCTGTAGCGTCTGTATAATTATAATGTTGCCCAGTGTGA
GGGAAAGAGCTTTCCTACTTGCACTCTTCTACCAAGGCCCTGTTAGTGCACTGATTATAG
TACTGACAGATAAACCTAGATAAAGAGATAGAGAGTGAGTACATGCACACTCATGTGCAA
ACCCACTCAGAGATGCATTTGGAACAGTGCTACTGAAAGGCAGTAGTCATTTTCAAGACT
GAATTCCAAACATGGTTTATTGGTGAGTTAGGAACATGTAAGGCCAAGTACACTGAGAGC
CTTTTTGAAAGTAATTGAGTGGAAACTTGATGCCATTCTAAATCAAGGCATATCCAGGTG
GCCCGGTTGAACTCACTCCACTGTACCCAGTCTCAAAGGCCAGGTTGCTAAGAAACCAGG
AGTAAAAGAGTCAAGTGACCATCATTTCACCTGCTGCTTGCCCCCAATAGTAGTCTCTGT
GAGGCCTTACTGACCTCACCTAGGAAGTGATTTTTGAGCCCTTGTTTCAGGGCTGTGGCC
TCCCTGCTCTATCCTGAATAAAGCAGACAGGTGTGCAGATTTTGGCCATGAAAGCATGGC
TAATAGGGCCACAGTCCCTTTAAAGAAACATGGTTTGACTCTGGTTTTCTTGGGGGAAAA
TACCACAATCACCGATGCAAACATTGGAAGATTATTGAGAGCCCTAGAAAGCTGCTGTGA
TCCCAGTAGAAAATATGTCCCAGAAATGTCATGAGATTGCTGTGTGTTGCCTGGGACACA
GATCAAGGGCCTATCTTGGAGAGCTGGGGACCAGCAGTCTGCCTGGAGGCCAGGGAGCAG
TGGCTGAGTAGCTCTGCCTTTGCTCTGGTCTATACCTTAAGAATGCCAAAGAATGAATTT
CAACGCCTGCCTTTGGCACTCTGACTTAAAGTGCAAAAAGCTTCTGTGGCGAGGCATGCT
ATCATGGAATGAGACTGGCTTGCCCTAGGCTTAATGGATGGGCAGTCATTTTGCAGAGGC
TATGGGAAGAGGGTGATAATAGAAGAGTGGCAGCTATAGGAAATTATCAACATACCTTGG
CCAGCAAGTTAGAGAATCTGGCAATGGATGAACTGAAAGTGATGAACTGGCAGGGATAAC
AAAGAACCTAACATTTATTAAGCACGTATTTATTAACTGCTCAGTGTTTCATATTCATGC
AAGTATTCTCATTTTACAGAGAAAGAAATTATGGCCCAGGGGGCTAAAGTAAACAACTCA
AGGGCACATAGAAAGTAAATAAAAGGACTGTGATTTGAATCCAGGCCACTCTTAGCCCAT
GCTGTTTTCCCTTTGCCACACTGTGGTAGGTGTTTGAACAGAGGCCACATTACTAGAGTT
GGCATGACTCTTGACTCTTGCCTGCCTAACAAAATATTGAAAGGCAAACATTTGAAGGAG
GGAGGGGGTGCAGGTTCAGTTTATATGGAAATGCAAACTGGGCTGGAAGATATTCCTGAG
TTAGGCTTTCTCTTCATATTCAGCTTGCACATTTGGTAATGTTTTTAAGATGATCATCTA
ATTTTATTTTGTGAAGTGAAGGATTTGTGTTTTAGTTGGCAGTTGTTAAGTCCTTGGCTT
GCCATTTTTCAAAAAGTAAAAAGGTCCTCACAGGTGTCTCCATACTTCGCCAAGGTTGTA
GCATGGGCAGTTTCAGTTTCAGCCTAAGAGACTGGTGACATCCACAAATGCAGTTTTAGA
AGCAGAAAAGGTCTTGGTGCCTCTGCAGTACTTGATGTATTGGGGTCAAATCTCTACAAA
TTTTTCTGTGGTGATAGCAAAATCAAGAGATGGCTTACAAAAAGAAATATTGAATTTTTA
TTTTTGAAGTTTTTGTTTTTTAAAAGGTTGGGGGTGTTCAGCCACTGAGGGACAAAACTT
AGCATCTAATTTCAATTATAGTGTCATGCAGAGTATTTCTAAAGTAATTGGTTATCATGG
GAAAGTATTCTCTTTTCAAGAAGTTCTTTGATTCTGTAATAACTAGAACAAATAAAGTAG
TAAAAGAAGAAATAGTTCTGTGACTAGGAAAAAATTGCTTTTGAGAGAACATAGATCAAT
TATACTACTTCTAAGGTAGCTGCAGATAAGTGGCCTTGACACATTACAAGCCTGGAAAAA
AACATCAGAAATAATAAAAAATTTCAGAGAGAATCAAGATACCTTTTTTTTTCTTTTTTT
TTTCTTTTTTTTATTATACTCTAAGTTTTAGGGTACATGTGCACATTGTGCAGGTTAGTT
ACATATGTATACATGTGCCATGCTGGTGCGCTGCACCCACTAATGTGTCATCTAGCATTA
GGTATATCTCCCAGTGCTATCCCTCCCCCCTCCCCCGACCCCACCACAGTCCCCAGAGTG
TGATATTCCCCTTCCTGTGTCCATGTGATCTCATTGTTCAATTCCCACCTATGAGTGAGA
ATATGCGGTGTTTGGTTTTTTGTTCTTGCGATAGTTTACTGAGAATGATGGTTTCCAATT
TCATCCATGTCCCTACAAAGGATATGAACTCATCATTTTTTATGGCTGCATAGTATTCCA
TGGTGTATATGTGCCACATTTTCTTAATCCAGTCTATCATTGTTGGACATTTGGGTTGGT
TCCAAGTCTTTGCTATTGTGAATAGTGCCGCAATAAACATACGTGTGCATGTGTCTTTAT
AGCAGCATGATTTATACTCATTTGGGTATAT
acccagtaatgggatggctgggtcaaatggtatttctagttctagatccctgaggaatcg
ccacactgacttccacaatggttgaactagtttacagtccaaccaacagtgtaaaagtgt
tcctatttctccgcatcctctccagcacctgttgtttcctgactttttaatgattgccat