Gene NXF2 Variant 2
DNA : 79.46 KbNT_011651
mRNA : 2322 bp NM_022053
CDS : 1881 bp NP_071336
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  63 bp
gccccccgtcccccgagccccaggagggggaggggcaggaatctggctccgcctcccagt
atggagatgattggtcaaaggaggtcacctgaccaagctgagccaattgaagtcctctcc
ccactgctttgagaaggaaccgttaagacgctgggccccacccacaagattgcgtcttgt
TTGTGGCAAGATTCTGAGGGGAAGTGTAGCTCCCAGGTTGGTTCCAAGTCTTCTTCCAAT
TAG
gtaaattacaacaatatcttttccataaatttcctttcttttcttttttgcctttttttt
tttttttttttttttttgagacggagtttggctcttgttgcccaggctggggcgtaatgt
cgcgatctcggctcaccacaacccccacctcccgggttcaagcgattctcctgcctcact
EXON 2  122 bp
tcttatataaccatagaaaaattaccaaaactaactactacattacattgatgcactaat
tgacattactacatcgatgttaattaccaacagttagcattgatgtagtactattaacta
atctacagattttatgtgaatttcaccagatatctcactgatgtcctttttctattctag
GATCTTATCCAGGACGCTTCATTGCATTTGGTCTTCATTTCTCCTTAGTCTCCTCCAGGC
TGACATTTCCTCAATCTTTATTGGTCTTCCACAGCCCTGACACTTTTGGAGATACCAGTC
AG
gtattttgtggaatgtctctcaatttgtgtttgtctcatgttttcttatgattagattga
agttgtgcatttgtagcaagcacacctgttttattctcctccctttcccagtggcgaggg
agggattcccaccctagtgttatgggggcggctgaacacatggtaccctatactggacag
EXON 3  96 bp
ggtgataacatttggtacatcatgaaagcggtattgggtgaatgaagttgagcaaatagc
aagattgtgcttaaacttacggggtttcaaatattgcttgtcagatggttagagaatatt
gtcacttgtgatatttgatattacatgtaggttgaataatctatttttctctcatttcag
CATTTCCAAGTTCGTTCTGTGAGACTGTAGTGTCAGGACAAAGCAACAACAAAATGTGCT
CTACTCTAAAGAAGTGTGGGACATACAGAACTGAAG
gtaaacgaatactgtaggatttttttagatgatatgctaataaacaacacgagtctcaaa
gggggggctactttccccaacttgtatgggaatggaacatttttttccacagagcatttg
aggtaccagtgttcttcagaaaatatttggggaaaccctgttcagactacatcttctaac
EXON 4  190 bp
ctaccctgattgtgccacctgtgagataaggctcttgtatctggacaggcagaggagttt
gttttctggggcttatgtggcgggttggcactttgctagccctaccatggagttagctca
cgacgtggtacgtggtaagtggaccattgatgtgtctcaaacttgtctttttgttctcag
TTGCAGAATGCCATGACCATGGTAGCACTTTTCAAGGAAGAAAGAAAGGTGGGAGTTCTT
TCCGGGATAATTTTGACAAGAGGAGCTGTCATTATGAACATGGTGGGTATGAGCGCCCGC
CTTCACACTGCCAGGAGAATGATGGAAGCGTGGAGATGAGGGATGTCCACAAGGACCAAC
AACTAAGACA
gtaagtgaccaggcagcctggtttgcacgtagcagcccccgggactgtgcaaccctttca
ttctctgtggtcttccttttcttctctcattagagaactgacgaatgctggaagtggaat
agtggctgagcaatcctaattgtagccctggcgtcagtgagtggagcatgtataggagac
EXON 5  151 bp
gtgcaaccctttcattctctgtggtcttccttttcttctctcattagagaactgacgaat
gctggaagtggaatagtggctgagcaatcctaattgtagccctggcgtcagtgagtggag
catgtataggagactttcttagatttaatggatacccgccttctctcctcttccccacag
CACTCCTTATAGCATCCGATGCGAAAGAAGAATGAAATGGCATAGTGAAGACGAAATCCG
TATTACCACGTGGAGAAATAGAAAACCTCCGGAGAGAAAAATGAGTCAGAACACACAGGA
TGGATACACAAGGAACTGGTTTAAGGTCACA
gtgagtatcttggtggggtctgcattaggtggactattctggaacctgatagaaggaaga
ccacttaaaacaccctaagttgattatttggaggagagcttcggaatggggggaaaggga
gtttagggcatctatatttggcacaaaaataagaaatcatgtcagcggtcctttctttag
EXON 6  84 bp
tagggcatctatatttggcacaaaaataagaaatcatgtcagcggtcctttctttagaaa
tctaagctaagtagaaggttggaaagaaagaaaaaaaaaacccagctggttggttctgtt
ctccatccttagttccacgttgtctctcccttccctcctatttcttctttttacccttag
ATTCCTTACGGGATAAAGTATGACAAGGCATGGCTAATGAATTCAATCCAGAGCCATTGC
AGTGACCGCTTCACTCCGGTTGAT
gtaagagaggatggtgaagccagatgagtgggcatgggggacggggagaggcctggctca
gcaggggccattggcctctgacgctgttgctcttgccttcactccctgtagttccactac
gtccgaaatcgggcatgcttctttgtccaggatgctagcgctgcctccgcattgaaggat
EXON 7  105 bp
aagtatgacaaggcatggctaatgaattcaatccagagccattgcagtgaccgcttcact
ccggttgatgtaagagaggatggtgaagccagatgagtgggcatgggggacggggagagg
cctggctcagcaggggccattggcctctgacgctgttgctcttgccttcactccctgtag
TTCCACTACGTCCGAAATCGGGCATGCTTCTTTGTCCAGGATGCTAGCGCTGCCTCCGCA
TTGAAGGATGTCAGTTATAAGATTTATGATGATGAGAACCAAAAG
gtgtgtgccgagggcatgccctgtacttagtctctgggcaggaggacaggccagggggct
ggtcatcctctttgggattagaggtcctggtacttaccaccctgccttcctgcagatatg
tatatttgtcaatcattctactgcgccctactctgtgaagaataagttgaagccaggcca
EXON 8  81 bp
atgctagcgctgcctccgcattgaaggatgtcagttataagatttatgatgatgagaacc
aaaaggtgtgtgccgagggcatgccctgtacttagtctctgggcaggaggacaggccagg
gggctggtcatcctctttgggattagaggtcctggtacttaccaccctgccttcctgcag
ATATGTATATTTGTCAATCATTCTACTGCGCCCTACTCTGTGAAGAATAAGTTGAAGCCA
GGCCAAATGGAGATGCTAAAG
gtaatacagactcaaggatcattgtatgtccacttcctggacccacctcttcttcccctg
gccccctctttccctgtcaccacaccaccaccaccaccaccatcaccagagccccagagc
ctctgtcttcatctctatctctgcagctgaccatgaacaaacggtacaatgtctcccagc
EXON 9  70 bp
taagttgaagccaggccaaatggagatgctaaaggtaatacagactcaaggatcattgta
tgtccacttcctggacccacctcttcttcccctggccccctctttccctgtcaccacacc
accaccaccaccaccatcaccagagccccagagcctctgtcttcatctctatctctgcag
CTGACCATGAACAAACGGTACAATGTCTCCCAGCAAGCTCTTGATCTCCAGAATCTCCGC
TTTGACCCAG
gtaaggctgacagcagcaattctaagacaagcgggggcagagaggtctgcctgggaggga
gacttaggaatggcaatttacagaggggttggggctggctctggtccagccagggccctc
ccagccttccgattcccttctcttggcttcttcaagacttgatgggccgtgacattgata
EXON 10  89 bp
tccagaatctccgctttgacccaggtaaggctgacagcagcaattctaagacaagcgggg
gcagagaggtctgcctgggagggagacttaggaatggcaatttacagaggggttggggct
ggctctggtccagccagggccctcccagccttccgattcccttctcttggcttcttcaag
ACTTGATGGGCCGTGACATTGATATAATCCTGAATCGAAGAAACTGCATGGCTGCCACCC
TGAAGATCATTGAAAGAAATTTCCCTGAG
gtgaagccttaggctcagtgctggtatttagttagaggggtggaagggataaggtggagg
gcagatttgtctctgaggcccaagatagtagccgccactctaactcttcttgacccaaag
ctgttgtctttgaacttgtgcaacaacaagctgtaccagctggatggcctttctgacatt
EXON 11  108 bp
ctgaatcgaagaaactgcatggctgccaccctgaagatcattgaaagaaatttccctgag
gtgaagccttaggctcagtgctggtatttagttagaggggtggaagggataaggtggagg
gcagatttgtctctgaggcccaagatagtagccgccactctaactcttcttgacccaaag
CTGTTGTCTTTGAACTTGTGCAACAACAAGCTGTACCAGCTGGATGGCCTTTCTGACATT
ACAGAGAAGGCTCCCAAAGTCAAGACCCTGAATCTCTCCAAAAATAAG
gtgagaagggggagccagatcaactttgggtggagggcaggacacatcaggataatggca
acagccaggcagtggcacctgtgggtgactatgagggccgggggaattcagggcccaggg
tcctgggtgtctctctttccctggccctccttctccagtttcctccccatctttcttagc
EXON 12  110 bp
ggtgagaagggggagccagatcaactttgggtggagggcaggacacatcaggataatggc
aacagccaggcagtggcacctgtgggtgactatgagggccgggggaattcagggcccagg
gtcctgggtgtctctctttccctggccctccttctccagtttcctccccatctttcttag
CTGGAGTCGGCGTGGGAGTTGGGCAAGGTGAAAGGGCTGAAGCTCGAAGAGCTATGGCTA
GAAGGGAACCCGTTGTGCAGCACCTTCTCGGACCAGTCCGCCTATGTAAG
gtcagtggcaaccccggtcacccttcctgggcacctttgctccctgggtgactgagctgt
gtctgaaggtgcccttctgcaggaagaagcagccttggtcctctgggaggaccacagacc
tcccttcctactctctctctctctctctctctcctctctctctgtcactcactcatctgt
EXON 13  37 bp
aaagccctggagcctgggctcccagtgctgcttcttgtagcactggagaaaagggagtca
ggacagtctagatggaagctaaccaggaggaaggagagggaggagtgtgagagggagtgg
gagagagactgtgcaaccctgaactgtcagtcacttcattcaatttttggttttggacag
TGCCATCCGGGATTGTTTCCCCAAGTTGTTACGCCTG
gtaagtatgtataataccgtcatcattgtctcctcttactcaagaaaaggacctccacgc
ctgccctcaagtcctttgggtcttgcctagattacatgcttgtatcagaccctcatccat
tttacaggcatggattcctgaaaaagacaagaatattctccctggaaaatgtgtcccccc
EXON 14  69 bp
cacacatttgcatgtgatagtagagatgtccagcaccccatgagaaagccacccactgga
atttccagggccatttcccacctagcctctgatgcttgtctccctgggcatgttcatctt
atcgatcatccagctccatctccttggtctccactgctgacttcctctttccttctccag
GACGGCCGAGAGTTATCCGCACCAGTGATTGTTGACATTGACAGCTCTGAGACAATGAAA
CCCTGCAAG
gtgaggaagaaggaccaagcaagatttgggttgctgtaagggaggctttgtccaccgcat
agatccaaattgtcttttgatttcaggaaaactttactggatctgagaccctaaagcatt
tagtcctgcaattcctgcagcagtgagtatccctgggaccatgaggaaggggagggctga
EXON 15  56 bp
gctgacttcctctttccttctccaggacggccgagagttatccgcaccagtgattgttga
cattgacagctctgagacaatgaaaccctgcaaggtgaggaagaaggaccaagcaagatt
tgggttgctgtaagggaggctttgtccaccgcatagatccaaattgtcttttgatttcag
GAAAACTTTACTGGATCTGAGACCCTAAAGCATTTAGTCCTGCAATTCCTGCAGCA
gtgagtatccctgggaccatgaggaaggggagggctgagacaggctgggccacccgtgca
gcctgggagttttcaagtctcatctggggcccaggccacagagatagcctatcctcactg
cttccccacaggtattactcgatctatgactctggagatcgacagggtctcctcggtgct
EXON 16  108 bp
ttactggatctgagaccctaaagcatttagtcctgcaattcctgcagcagtgagtatccc
tgggaccatgaggaaggggagggctgagacaggctgggccacccgtgcagcctgggagtt
ttcaagtctcatctggggcccaggccacagagatagcctatcctcactgcttccccacag
GTATTACTCGATCTATGACTCTGGAGATCGACAGGGTCTCCTCGGTGCTTACCACGATGA
GGCCTGCTTCTCCTTGGCTATTCCCTTCGACCCCAAGGACTCAGCCCC
gtgagtatcacggctcagaccctgctctggggctgtgtgtctccccagcagacacaggcc
aactcctggaaatgcccacactggccggaccacccactcctgctcctctttttctcctag
gagcagcttgtgcaagtactttgaggatagcaggaatatgaaaacactcaaggacccctg
EXON 17  59 bp
ttaccacgatgaggcctgcttctccttggctattcccttcgaccccaaggactcagcccc
gtgagtatcacggctcagaccctgctctggggctgtgtgtctccccagcagacacaggcc
aactcctggaaatgcccacactggccggaccacccactcctgctcctctttttctcctag
GAGCAGCTTGTGCAAGTACTTTGAGGATAGCAGGAATATGAAAACACTCAAGGACCCCT
gtaagtgtgtgatggggaagagtgggcaaggtaagggggtgtgatgggaacaatcacagg
ggccaaggaccaggatgtggtagccccccgccctgccccgcccaccctgccattccttgc
ttctcctctcctctacagacctgaagggggaactgctgaggcgcacaaaacgtgacattg
EXON 18  116 bp
actttgaggatagcaggaatatgaaaacactcaaggacccctgtaagtgtgtgatgggga
agagtgggcaaggtaagggggtgtgatgggaacaatcacaggggccaaggaccaggatgt
ggtagccccccgccctgccccgcccaccctgccattccttgcttctcctctcctctacag
ACCTGAAGGGGGAACTGCTGAGGCGCACAAAACGTGACATTGTGGACTCCCTCAGTGCGT
TGCCCAAAACTCAGCATGACCTCAGCTCCATCCTGGTGGACGTGTGGTGCCAGACG
gtgagcacctgcttcctcccttgggcaggcccagagagccagaggtgggtaggaggttaa
ggaggatcctgagcacctgagcgcttccttttcaggaaaggatgctctgcttttctgtca
atggggttttcaaggaaggtgagtgtctgtatagtcccctccccagatcccccactgctc
EXON 19  43 bp
acgtgacattgtggactccctcagtgcgttgcccaaaactcagcatgacctcagctccat
cctggtggacgtgtggtgccagacggtgagcacctgcttcctcccttgggcaggcccaga
gagccagaggtgggtaggaggttaaggaggatcctgagcacctgagcgcttccttttcag
GAAAGGATGCTCTGCTTTTCTGTCAATGGGGTTTTCAAGGAAG
gtgagtgtctgtatagtcccctccccagatcccccactgctccctccccctggctgggct
ccctctcagaactcccccagcttccctgctttcgttcctttcctttccttcctcttcttt
cttccgtgttttcccacccccactctgccttcaaaccaccctgatctgacctaggtccat
EXON 20  73 bp
ttcctgttgctgccctccccattcctgccacatccgcctgactccaagtgaacaattgtc
ctggtctgccccctcccccccttctgtgtgagtgtcaagcaatactctgactggggatca
ccgtgtgagcatgttaaagcctgtgcaactctaaggtggtggtgtttgttgtctttgaag
TGGAAGGACAGTCTCAGGGTTCTGTTCTCGCCTTCACCCGGACCTTCATTGCTACCCCTG
GCAGCAGTTCCAG
gttagtgctgtgttgtgggtgggagcacccatccaagcttggggccagtgttgtggaaat
gtggtgggtgcagtcctccgggtgttctcaatattgtggaaggccgacaggaagatccaa
ggagcagtctagcctagtgtttaagagtgtgggccctggagtcagaatacagattctgtt
EXON 21  183 bp
ccaaaggtggactctgtgggagggttagagggtaccagccaaaaaatctgggaggcaggc
acagttagggatatggaaggaatttggttgttgagtggcagtggttaagaaggatcctgt
tgttgggggtgcggagttatctacttgtccagtttgagggtgcatttttctttcctccag
TCTGTGCATCGTGAATGACGAGCTGTTTGTGAGGGATGCCAGCCCCCAAGAGACTCAGAG
TGCCTTCTCCATCCCAGTGTCCACACTCTCCTCCAGCTCTGAGCCCTCCCTCTCCCAGGA
GCAGCAGGAAATGGTGCAGGCTTTCTCTGCCCAGTCTGGGATGAAACTGGAGTGGTCTCA
GAA
gtgagtgctgggagtacatggggatgggggctgttgggacatcagaggaatgagtaatgg
aaactcacatgcaatttggaaaaataactatctgggtattttgcttccaaaaaaagtggg
tccatgaaaaaggtatcatacttttatactggtatatgtaaatatttttttaaatggcat
EXON 22  61 bp
gcattaatgtcagggatgggcgttttggttttccccaggccttttttcattgttacaata
gtgctcatattggtacatgtgacccagcaaaaaggtagcatagattaagggtggcattgc
atagtcagcgtgtctgtcctgggctagtaatggagagcacctgttcttctcccaccccag
GTGCCTTCAGGACAATGAGTGGAACTACACTAGAGCTGGCCAGGCCTTCACTATGCTCCA
G
gtgaggtctgggaatcaagtgggtaaaagacagctgtctctgggtcgtcaggagggccaa
gaagatggaggccaggtagtgtggggatggaacccagtgcacctggctctactaacatcc
caactccttttctttactttctctagaccgagggcaagatccccgcagaggccttcaagc
EXON 23  248 bp
cactagagctggccaggccttcactatgctccaggtgaggtctgggaatcaagtgggtaa
aagacagctgtctctgggtcgtcaggagggccaagaagatggaggccaggtagtgtgggg
atggaacccagtgcacctggctctactaacatcccaactccttttctttactttctctag
ACCGAGGGCAAGATCCCCGCAGAGGCCTTCAAGCAAATCTCCTAAAAGGAGCCCTCCGAT
GTCTTCTTTGTCTTCGTTCACATCCTCTTTGTTTCCTCTTTTCACCAGCCTAAGGCCTGG
CTGACCAGGAAGCCAACGTTAACTTGCAGGCCACGTGACATAACCACCCAAAGAGCCAGT
TGCTCTGTGTATTCGCCCCACTCATGATCACCATTTTATTTTCATAATAAAGAGTGACGT
TACACGTT
gtacattgtgtgccctggattgctcttcccctgccccagccgtgagccagcgggaccagg
actgaaagcactgcatccctgttcatccctggctggccttagcagatacatgaatctggc
ttgccttcataggtaattttgtccgtaaatcctcatgagaaaggacacacgctccttcca