Gene NXF2 Variant 1
DNA : 102.69 KbNT_011651
mRNA : 2884 bp NM_017809
CDS : 5529 bp NP_060279
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  40 bp
tctcctcgattataccacaaaatggctaaccaaagcagccacagacatcactacactatg
tccgagttctcctgactcacctagctcctcctgcagcatggcgtgttcacttccaagcgg
ggcaggtaacaattcagagccccccagtccaacaatggtgctataccaaggctacctgaa
CCTCCTCCTCTGGGATCTTGAAAACGTAGAATTCCCAGAG
gtagggatgtgtgtttgggcattgccttgttctatggtattcagtgcctccattcaaacc
ctcctcttctgatgggctgtccttcgctccctcaccagactctgctgatggacagaatcc
ggctccaggaactggcattccagttgcaccagttaactgtcctggcctcagtcttgctag
EXON 2  182 bp
gccccccagtccaacaatggtgctataccaaggctacctgaacctcctcctctgggatct
tgaaaacgtagaattcccagaggtagggatgtgtgtttgggcattgccttgttctatggt
attcagtgcctccattcaaaccctcctcttctgatgggctgtccttcgctccctcaccag
ACTCTGCTGATGGACAGAATCCGGCTCCAGGAACTGGCATTCCAGTTGCACCAGTTAACT
GTCCTGGCCTCAGTCTTGCTAGTGGCCAGAAGCTTCTCTGGTGAAGTTTTATTCAGATCA
CCTGAATTTGTGGATAGACTGAAATGCACCACCAAGGCCCTAACTGAGGAATTTATCTCC
AG
gtaagattcatagatctctgttagagagggaaatgtgtggtatttgggacataggtaata
tcaatactattattgcttattcttcatcacaaaccacacaaaggcccttggaaatgatct
tcaaagattttggtatctttgataatttgtattgaggtttgggatacagaaaataaaact
EXON 3  164 bp
tggatcaggtggtaccttgcgggtaacaatgagtgtatttcatctgcccagtggctaatg
ctgtcttctggtggcagagagccagaattcttcctggaataggcctggcttgtggtatga
ggctctctgggctttgcccctctgccaggcccactctgcattctatcccttattatctag
GCCTGAAGAGACTATGCTGAGTGTGAGTGAACAGGTGTCTCAGGAAGTCCATCAAGGCCT
TAAGGACATGGGCCTCACTACTCTGAGCAGTGAAAACACAGCATCTCTTCTAGGCCAACT
CCAGAACATCACCAAGAAAGAGAACTGCATTCGTAGCATTGTTG
gtaagaatctccatggtcgtcgtgcagaaaagtggcaagaatgtggggcatgggtgggta
gaccttaccctgaatgtgagttacctaagcatttaaaaatgaaaaggcatgatcatttgg
gaagttttttagctttagtttcctcgtctataatgtgcactgttcaaatagatctttctc
EXON 4  99 bp
ccaaatgagcagagaggtcagtgaataactcggttaatgcaaaactttggtgagcagata
gagcaaaggcattgtgaatttcttctgtaccgtcttcgttcctcttgtcattgtttttcc
ctgctcacagatcagtggatccgtttttttctcaaatgctgtttgcttcatggcatgcag
GAGTCTCTGCTACACTTTCCTGGAGGCCTCATTCTCATTGAAAAGGAGTTGGCAGAACTG
GGCTGGAAGTTTCTCAATCTGATGCATCATAATCAGCAG
gtatttggcccatactatgctgagatcctaaaacacatcatccatccagctcaagcacaa
gaaacagatgtggagcctaactgatagtgctggaccccagctatggcaacagggactcag
gagagagaggtcagcatgtttctgggaggacatcacctgtggttagtcgaacagtcagcc
EXON 5  140 bp
tgttgtacagaaagctctaactgagggtaagaaccggtgtttgtttgtttgtttatatat
ttatttatctggtcttctttgagtgagtaagggaaaatcatttcactttcttgggctttg
tcttcatctataaaattctatacttgactaaattactgattttcttgttcaattttatag
AGTCATTTTTCACAAAACGAAATCTTTCCAGAAGATCACGAATAAGAGAGATCAAAGCTA
GGCAGCTTGAGTTGAAGTAGAGCTGGAAGAAGGAGTTTTGAGGACTGTTTCAAAACCACT
GGACTAGATGATCTCTAAAG
gttcctgtattattttcttcttttcttatggctgttgtaacaaattaccccctgaacttt
gtggcttaaaataacatgcatgtattctcttatcatcctgattgtcagaagaccaaaatc
agtttcagtgggtgaaaatcagggagtcagtagggccaggctccctctggaagctctaag
EXON 6  122 bp
tcttatataaccatagaaaaattaccaaaactaactactacattacattgatgcactaat
tgacattactacatcgatgttaattaccaacagttagcattgatgtagtactattaacta
atctacagattttatgtgaatttcaccagatatctcactgatgtcctttttctattctag
GATCTTATCCAGGACGCTTCATTGCATTTGGTCTTCATTTCTCCTTAGTCTCCTCCAGGC
TGACATTTCCTCAATCTTTATTGGTCTTCCACAGCCCTGACACTTTTGGAGATACCAGTC
AG
gtattttgtggaatgtctctcaatttgtgtttgtctcatgttttcttatgattagattga
agttgtgcatttgtagcaagcacacctgttttattctcctccctttcccagtggcgaggg
agggattcccaccctagtgttatgggggcggctgaacacatggtaccctatactggacag
EXON 7  96 bp
ggtgataacatttggtacatcatgaaagcggtattgggtgaatgaagttgagcaaatagc
aagattgtgcttaaacttacggggtttcaaatattgcttgtcagatggttagagaatatt
gtcacttgtgatatttgatattacatgtaggttgaataatctatttttctctcatttcag
CATTTCCAAGTTCGTTCTGTGAGACTGTAGTGTCAGGACAAAGCAACAACAAAATGTGCT
CTACTCTAAAGAAGTGTGGGACATACAGAACTGAAG
gtaaacgaatactgtaggatttttttagatgatatgctaataaacaacacgagtctcaaa
gggggggctactttccccaacttgtatgggaatggaacatttttttccacagagcatttg
aggtaccagtgttcttcagaaaatatttggggaaaccctgttcagactacatcttctaac
EXON 8  190 bp
ctaccctgattgtgccacctgtgagataaggctcttgtatctggacaggcagaggagttt
gttttctggggcttatgtggcgggttggcactttgctagccctaccatggagttagctca
cgacgtggtacgtggtaagtggaccattgatgtgtctcaaacttgtctttttgttctcag
TTGCAGAATGCCATGACCATGGTAGCACTTTTCAAGGAAGAAAGAAAGGTGGGAGTTCTT
TCCGGGATAATTTTGACAAGAGGAGCTGTCATTATGAACATGGTGGGTATGAGCGCCCGC
CTTCACACTGCCAGGAGAATGATGGAAGCGTGGAGATGAGGGATGTCCACAAGGACCAAC
AACTAAGACA
gtaagtgaccaggcagcctggtttgcacgtagcagcccccgggactgtgcaaccctttca
ttctctgtggtcttccttttcttctctcattagagaactgacgaatgctggaagtggaat
agtggctgagcaatcctaattgtagccctggcgtcagtgagtggagcatgtataggagac
EXON 9  151 bp
gtgcaaccctttcattctctgtggtcttccttttcttctctcattagagaactgacgaat
gctggaagtggaatagtggctgagcaatcctaattgtagccctggcgtcagtgagtggag
catgtataggagactttcttagatttaatggatacccgccttctctcctcttccccacag
CACTCCTTATAGCATCCGATGCGAAAGAAGAATGAAATGGCATAGTGAAGACGAAATCCG
TATTACCACGTGGAGAAATAGAAAACCTCCGGAGAGAAAAATGAGTCAGAACACACAGGA
TGGATACACAAGGAACTGGTTTAAGGTCACA
gtgagtatcttggtggggtctgcattaggtggactattctggaacctgatagaaggaaga
ccacttaaaacaccctaagttgattatttggaggagagcttcggaatggggggaaaggga
gtttagggcatctatatttggcacaaaaataagaaatcatgtcagcggtcctttctttag
EXON 10  84 bp
tagggcatctatatttggcacaaaaataagaaatcatgtcagcggtcctttctttagaaa
tctaagctaagtagaaggttggaaagaaagaaaaaaaaaacccagctggttggttctgtt
ctccatccttagttccacgttgtctctcccttccctcctatttcttctttttacccttag
ATTCCTTACGGGATAAAGTATGACAAGGCATGGCTAATGAATTCAATCCAGAGCCATTGC
AGTGACCGCTTCACTCCGGTTGAT
gtaagagaggatggtgaagccagatgagtgggcatgggggacggggagaggcctggctca
gcaggggccattggcctctgacgctgttgctcttgccttcactccctgtagttccactac
gtccgaaatcgggcatgcttctttgtccaggatgctagcgctgcctccgcattgaaggat
EXON 11  105 bp
aagtatgacaaggcatggctaatgaattcaatccagagccattgcagtgaccgcttcact
ccggttgatgtaagagaggatggtgaagccagatgagtgggcatgggggacggggagagg
cctggctcagcaggggccattggcctctgacgctgttgctcttgccttcactccctgtag
TTCCACTACGTCCGAAATCGGGCATGCTTCTTTGTCCAGGATGCTAGCGCTGCCTCCGCA
TTGAAGGATGTCAGTTATAAGATTTATGATGATGAGAACCAAAAG
gtgtgtgccgagggcatgccctgtacttagtctctgggcaggaggacaggccagggggct
ggtcatcctctttgggattagaggtcctggtacttaccaccctgccttcctgcagatatg
tatatttgtcaatcattctactgcgccctactctgtgaagaataagttgaagccaggcca
EXON 12  81 bp
atgctagcgctgcctccgcattgaaggatgtcagttataagatttatgatgatgagaacc
aaaaggtgtgtgccgagggcatgccctgtacttagtctctgggcaggaggacaggccagg
gggctggtcatcctctttgggattagaggtcctggtacttaccaccctgccttcctgcag
ATATGTATATTTGTCAATCATTCTACTGCGCCCTACTCTGTGAAGAATAAGTTGAAGCCA
GGCCAAATGGAGATGCTAAAG
gtaatacagactcaaggatcattgtatgtccacttcctggacccacctcttcttcccctg
gccccctctttccctgtcaccacaccaccaccaccaccaccatcaccagagccccagagc
ctctgtcttcatctctatctctgcagctgaccatgaacaaacggtacaatgtctcccagc
EXON 13  70 bp
taagttgaagccaggccaaatggagatgctaaaggtaatacagactcaaggatcattgta
tgtccacttcctggacccacctcttcttcccctggccccctctttccctgtcaccacacc
accaccaccaccaccatcaccagagccccagagcctctgtcttcatctctatctctgcag
CTGACCATGAACAAACGGTACAATGTCTCCCAGCAAGCTCTTGATCTCCAGAATCTCCGC
TTTGACCCAG
gtaaggctgacagcagcaattctaagacaagcgggggcagagaggtctgcctgggaggga
gacttaggaatggcaatttacagaggggttggggctggctctggtccagccagggccctc
ccagccttccgattcccttctcttggcttcttcaagacttgatgggccgtgacattgata
EXON 14  89 bp
tccagaatctccgctttgacccaggtaaggctgacagcagcaattctaagacaagcgggg
gcagagaggtctgcctgggagggagacttaggaatggcaatttacagaggggttggggct
ggctctggtccagccagggccctcccagccttccgattcccttctcttggcttcttcaag
ACTTGATGGGCCGTGACATTGATATAATCCTGAATCGAAGAAACTGCATGGCTGCCACCC
TGAAGATCATTGAAAGAAATTTCCCTGAG
gtgaagccttaggctcagtgctggtatttagttagaggggtggaagggataaggtggagg
gcagatttgtctctgaggcccaagatagtagccgccactctaactcttcttgacccaaag
ctgttgtctttgaacttgtgcaacaacaagctgtaccagctggatggcctttctgacatt
EXON 15  108 bp
ctgaatcgaagaaactgcatggctgccaccctgaagatcattgaaagaaatttccctgag
gtgaagccttaggctcagtgctggtatttagttagaggggtggaagggataaggtggagg
gcagatttgtctctgaggcccaagatagtagccgccactctaactcttcttgacccaaag
CTGTTGTCTTTGAACTTGTGCAACAACAAGCTGTACCAGCTGGATGGCCTTTCTGACATT
ACAGAGAAGGCTCCCAAAGTCAAGACCCTGAATCTCTCCAAAAATAAG
gtgagaagggggagccagatcaactttgggtggagggcaggacacatcaggataatggca
acagccaggcagtggcacctgtgggtgactatgagggccgggggaattcagggcccaggg
tcctgggtgtctctctttccctggccctccttctccagtttcctccccatctttcttagc
EXON 16  110 bp
ggtgagaagggggagccagatcaactttgggtggagggcaggacacatcaggataatggc
aacagccaggcagtggcacctgtgggtgactatgagggccgggggaattcagggcccagg
gtcctgggtgtctctctttccctggccctccttctccagtttcctccccatctttcttag
CTGGAGTCGGCGTGGGAGTTGGGCAAGGTGAAAGGGCTGAAGCTCGAAGAGCTATGGCTA
GAAGGGAACCCGTTGTGCAGCACCTTCTCGGACCAGTCCGCCTATGTAAG
gtcagtggcaaccccggtcacccttcctgggcacctttgctccctgggtgactgagctgt
gtctgaaggtgcccttctgcaggaagaagcagccttggtcctctgggaggaccacagacc
tcccttcctactctctctctctctctctctctcctctctctctgtcactcactcatctgt
EXON 17  37 bp
aaagccctggagcctgggctcccagtgctgcttcttgtagcactggagaaaagggagtca
ggacagtctagatggaagctaaccaggaggaaggagagggaggagtgtgagagggagtgg
gagagagactgtgcaaccctgaactgtcagtcacttcattcaatttttggttttggacag
TGCCATCCGGGATTGTTTCCCCAAGTTGTTACGCCTG
gtaagtatgtataataccgtcatcattgtctcctcttactcaagaaaaggacctccacgc
ctgccctcaagtcctttgggtcttgcctagattacatgcttgtatcagaccctcatccat
tttacaggcatggattcctgaaaaagacaagaatattctccctggaaaatgtgtcccccc
EXON 18  69 bp
cacacatttgcatgtgatagtagagatgtccagcaccccatgagaaagccacccactgga
atttccagggccatttcccacctagcctctgatgcttgtctccctgggcatgttcatctt
atcgatcatccagctccatctccttggtctccactgctgacttcctctttccttctccag
GACGGCCGAGAGTTATCCGCACCAGTGATTGTTGACATTGACAGCTCTGAGACAATGAAA
CCCTGCAAG
gtgaggaagaaggaccaagcaagatttgggttgctgtaagggaggctttgtccaccgcat
agatccaaattgtcttttgatttcaggaaaactttactggatctgagaccctaaagcatt
tagtcctgcaattcctgcagcagtgagtatccctgggaccatgaggaaggggagggctga
EXON 19  56 bp
gctgacttcctctttccttctccaggacggccgagagttatccgcaccagtgattgttga
cattgacagctctgagacaatgaaaccctgcaaggtgaggaagaaggaccaagcaagatt
tgggttgctgtaagggaggctttgtccaccgcatagatccaaattgtcttttgatttcag
GAAAACTTTACTGGATCTGAGACCCTAAAGCATTTAGTCCTGCAATTCCTGCAGCA
gtgagtatccctgggaccatgaggaaggggagggctgagacaggctgggccacccgtgca
gcctgggagttttcaagtctcatctggggcccaggccacagagatagcctatcctcactg
cttccccacaggtattactcgatctatgactctggagatcgacagggtctcctcggtgct
EXON 20  108 bp
ttactggatctgagaccctaaagcatttagtcctgcaattcctgcagcagtgagtatccc
tgggaccatgaggaaggggagggctgagacaggctgggccacccgtgcagcctgggagtt
ttcaagtctcatctggggcccaggccacagagatagcctatcctcactgcttccccacag
GTATTACTCGATCTATGACTCTGGAGATCGACAGGGTCTCCTCGGTGCTTACCACGATGA
GGCCTGCTTCTCCTTGGCTATTCCCTTCGACCCCAAGGACTCAGCCCC
gtgagtatcacggctcagaccctgctctggggctgtgtgtctccccagcagacacaggcc
aactcctggaaatgcccacactggccggaccacccactcctgctcctctttttctcctag
gagcagcttgtgcaagtactttgaggatagcaggaatatgaaaacactcaaggacccctg
EXON 21  59 bp
ttaccacgatgaggcctgcttctccttggctattcccttcgaccccaaggactcagcccc
gtgagtatcacggctcagaccctgctctggggctgtgtgtctccccagcagacacaggcc
aactcctggaaatgcccacactggccggaccacccactcctgctcctctttttctcctag
GAGCAGCTTGTGCAAGTACTTTGAGGATAGCAGGAATATGAAAACACTCAAGGACCCCT
gtaagtgtgtgatggggaagagtgggcaaggtaagggggtgtgatgggaacaatcacagg
ggccaaggaccaggatgtggtagccccccgccctgccccgcccaccctgccattccttgc
ttctcctctcctctacagacctgaagggggaactgctgaggcgcacaaaacgtgacattg
EXON 22  116 bp
actttgaggatagcaggaatatgaaaacactcaaggacccctgtaagtgtgtgatgggga
agagtgggcaaggtaagggggtgtgatgggaacaatcacaggggccaaggaccaggatgt
ggtagccccccgccctgccccgcccaccctgccattccttgcttctcctctcctctacag
ACCTGAAGGGGGAACTGCTGAGGCGCACAAAACGTGACATTGTGGACTCCCTCAGTGCGT
TGCCCAAAACTCAGCATGACCTCAGCTCCATCCTGGTGGACGTGTGGTGCCAGACG
gtgagcacctgcttcctcccttgggcaggcccagagagccagaggtgggtaggaggttaa
ggaggatcctgagcacctgagcgcttccttttcaggaaaggatgctctgcttttctgtca
atggggttttcaaggaaggtgagtgtctgtatagtcccctccccagatcccccactgctc
EXON 23  43 bp
acgtgacattgtggactccctcagtgcgttgcccaaaactcagcatgacctcagctccat
cctggtggacgtgtggtgccagacggtgagcacctgcttcctcccttgggcaggcccaga
gagccagaggtgggtaggaggttaaggaggatcctgagcacctgagcgcttccttttcag
GAAAGGATGCTCTGCTTTTCTGTCAATGGGGTTTTCAAGGAAG
gtgagtgtctgtatagtcccctccccagatcccccactgctccctccccctggctgggct
ccctctcagaactcccccagcttccctgctttcgttcctttcctttccttcctcttcttt
cttccgtgttttcccacccccactctgccttcaaaccaccctgatctgacctaggtccat
EXON 24  73 bp
ttcctgttgctgccctccccattcctgccacatccgcctgactccaagtgaacaattgtc
ctggtctgccccctcccccccttctgtgtgagtgtcaagcaatactctgactggggatca
ccgtgtgagcatgttaaagcctgtgcaactctaaggtggtggtgtttgttgtctttgaag
TGGAAGGACAGTCTCAGGGTTCTGTTCTCGCCTTCACCCGGACCTTCATTGCTACCCCTG
GCAGCAGTTCCAG
gttagtgctgtgttgtgggtgggagcacccatccaagcttggggccagtgttgtggaaat
gtggtgggtgcagtcctccgggtgttctcaatattgtggaaggccgacaggaagatccaa
ggagcagtctagcctagtgtttaagagtgtgggccctggagtcagaatacagattctgtt
EXON 25  183 bp
ccaaaggtggactctgtgggagggttagagggtaccagccaaaaaatctgggaggcaggc
acagttagggatatggaaggaatttggttgttgagtggcagtggttaagaaggatcctgt
tgttgggggtgcggagttatctacttgtccagtttgagggtgcatttttctttcctccag
TCTGTGCATCGTGAATGACGAGCTGTTTGTGAGGGATGCCAGCCCCCAAGAGACTCAGAG
TGCCTTCTCCATCCCAGTGTCCACACTCTCCTCCAGCTCTGAGCCCTCCCTCTCCCAGGA
GCAGCAGGAAATGGTGCAGGCTTTCTCTGCCCAGTCTGGGATGAAACTGGAGTGGTCTCA
GAA
gtgagtgctgggagtacatggggatgggggctgttgggacatcagaggaatgagtaatgg
aaactcacatgcaatttggaaaaataactatctgggtattttgcttccaaaaaaagtggg
tccatgaaaaaggtatcatacttttatactggtatatgtaaatatttttttaaatggcat
EXON 26  61 bp
gcattaatgtcagggatgggcgttttggttttccccaggccttttttcattgttacaata
gtgctcatattggtacatgtgacccagcaaaaaggtagcatagattaagggtggcattgc
atagtcagcgtgtctgtcctgggctagtaatggagagcacctgttcttctcccaccccag
GTGCCTTCAGGACAATGAGTGGAACTACACTAGAGCTGGCCAGGCCTTCACTATGCTCCA
G
gtgaggtctgggaatcaagtgggtaaaagacagctgtctctgggtcgtcaggagggccaa
gaagatggaggccaggtagtgtggggatggaacccagtgcacctggctctactaacatcc
caactccttttctttactttctctagaccgagggcaagatccccgcagaggccttcaagc
EXON 27  248 bp
cactagagctggccaggccttcactatgctccaggtgaggtctgggaatcaagtgggtaa
aagacagctgtctctgggtcgtcaggagggccaagaagatggaggccaggtagtgtgggg
atggaacccagtgcacctggctctactaacatcccaactccttttctttactttctctag
ACCGAGGGCAAGATCCCCGCAGAGGCCTTCAAGCAAATCTCCTAAAAGGAGCCCTCCGAT
GTCTTCTTTGTCTTCGTTCACATCCTCTTTGTTTCCTCTTTTCACCAGCCTAAGGCCTGG
CTGACCAGGAAGCCAACGTTAACTTGCAGGCCACGTGACATAACCACCCAAAGAGCCAGT
TGCTCTGTGTATTCGCCCCACTCATGATCACCATTTTATTTTCATAATAAAGAGTGACGT
TACACGTT
gtacattgtgtgccctggattgctcttcccctgccccagccgtgagccagcgggaccagg
actgaaagcactgcatccctgttcatccctggctggccttagcagatacatgaatctggc
ttgccttcataggtaattttgtccgtaaatcctcatgagaaaggacacacgctccttcca