Gene MECP2 Variant 1
DNA : 75.86 KbNT_025965
mRNA : 10182 bp NM_004992
CDS : 1461 bp NP_004983
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  69 bp
ggccatcacagccaatgacgggcgggctcgcagcggcgccgagggcggggcgcgggcgcg
caggtgcagcagcgcgcgggccggccaagagggcggggcgcgacgtcggccgtgcggggt
cccggcgtcggcggcgcgcgcgctccctcctctcggagagagggctgtggtaaaagccgt
CCGGAAAATGGCCGCCGCCGCCGCCGCCGCGCCGAGCGGAGGAGGAGGAGGAGGCGAGGA
GGAGAGACT
gtgagtgggaccgccgtggccgcgggcggggacccttgccggggggcgggggtcaggggc
gggacgtggcgcgggaggggcccgcggggtcggacgacacggctggcggatggcgtccct
cctctctaccctccccctcccgccgccgccggtggcgactctcccctcggcccgtcaccc
EXON 2  124 bp
tttagcactgtgtgttacgtgccagtaatttgcagcttatcctttgtttctagctaggta
agctgggaaatagcctagtactttgtctatgtgtttatcttcaaaatgtcccaaatagcc
ctgggaaaaaggtcgtgcagctcaatgggggctttcaacttacaattttctttgttttag
GCTCCATAAAAATACAGACTCACCAGTTCCTGCTTTGATGTGACATGTGACTCCCCAGAA
TACACCTTGCTTCTGTAGACCAGCTCCAACAGGATTCCATGGTAGCTGGGATGTTAGGGC
TCAG
gtaagtaaccttcctttttttttttttagtatatgtcctggtttggccatctgttttttt
tttttttaaaaaaaaaaaaaaaaggaaaagaggaaaaaaatatactactcttggacagta
taaaagtaccccaaagactaaagacataactgtgccaaactgtgccatataataaaaaaa
EXON 3  351 bp
aagaaatatttgggtcccagcttggcccgagtctctgttgtcctggggaaggacatcaag
atctgagtgtatgatggcctggggccttgcatgtggtgggggtccaagcctgcctctgct
cacttgttctgcagactggcatgttctctgtgatacttacatacttgtttaacacttcag
GGAAGAAAAGTCAGAAGACCAGGACCTCCAGGGCCTCAAGGACAAACCCCTCAAGTTTAA
AAAGGTGAAGAAAGATAAGAAAGAAGAGAAAGAGGGCAAGCATGAGCCCGTGCAGCCATC
AGCCCACCACTCTGCTGAGCCCGCAGAGGCAGGCAAAGCAGAGACATCAGAAGGGTCAGG
CTCCGCCCCGGCTGTGCCGGAAGCTTCTGCCTCCCCCAAACAGCGGCGCTCCATCATCCG
TGACCGGGGACCCATGTATGATGACCCCACCCTGCCTGAAGGCTGGACACGGAAGCTTAA
GCAAAGGAAATCTGGCCGCTCTGCTGGGAAGTATGATGTGTATTTGATCAA
gtaagtaagagcaactcctatctctacagggcagggagggcagggacaaggatccctcat
ggagcaggaaaatgtatgtgcccagggtggggtcggggggaacataaacaatgaacactg
agaccaggtgtgcttgaaatgaccgtgtacagaggtcgctgccctgagtgggaagttctc
EXON 4  9638 bp
cggcaggcagacgagtgagtggctttggtgacaggtcctcaggggcagccaggcagtgtg
actctcgttcaatagtaacgtttgtcagagcgttgtcaccaccatccgctctgccctatc
tctgacattgctatggagagcctctaattgttccttgtgtctttctgtttgtccccacag
TCCCCAGGGAAAAGCCTTTCGCTCTAAAGTGGAGTTGATTGCGTACTTCGAAAAGGTAGG
CGACACATCCCTGGACCCTAATGATTTTGACTTCACGGTAACTGGGAGAGGGAGCCCCTC
CCGGCGAGAGCAGAAACCACCTAAGAAGCCCAAATCTCCCAAAGCTCCAGGAACTGGCAG
AGGCCGGGGACGCCCCAAAGGGAGCGGCACCACGAGACCCAAGGCGGCCACGTCAGAGGG
TGTGCAGGTGAAAAGGGTCCTGGAGAAAAGTCCTGGGAAGCTCCTTGTCAAGATGCCTTT
TCAAACTTCGCCAGGGGGCAAGGCTGAGGGGGGTGGGGCCACCACATCCACCCAGGTCAT
GGTGATCAAACGCCCCGGCAGGAAGCGAAAAGCTGAGGCCGACCCTCAGGCCATTCCCAA
GAAACGGGGCCGAAAGCCGGGGAGTGTGGTGGCAGCCGCTGCCGCCGAGGCCAAAAAGAA
AGCCGTGAAGGAGTCTTCTATCCGATCTGTGCAGGAGACCGTACTCCCCATCAAGAAGCG
CAAGACCCGGGAGACGGTCAGCATCGAGGTCAAGGAAGTGGTGAAGCCCCTGCTGGTGTC
CACCCTCGGTGAGAAGAGCGGGAAAGGACTGAAGACCTGTAAGAGCCCTGGGCGGAAAAG
CAAGGAGAGCAGCCCCAAGGGGCGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCA
CCACCACCATCACCACCACTCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCCT
GCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTGAGCCCCA
GGACTTGAGCAGCAGCGTCTGCAAAGAGGAGAAGATGCCCAGAGGAGGCTCACTGGAGAG
CGACGGCTGCCCCAAGGAGCCAGCTAAGACTCAGCCCGCGGTTGCCACCGCCGCCACGGC
CGCAGAAAAGTACAAACACCGAGGGGAGGGAGAGCGCAAAGACATTGTTTCATCCTCCAT
GCCAAGGCCAAACAGAGAGGAGCCTGTGGACAGCCGGACGCCCGTGACCGAGAGAGTTAG
CTGACTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCT
CTTCTCCTTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTT
TTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGTGGGAGTAGTTGGAGCATTG
GGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTA
GCTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCA
GACAAGCTGTTGACCAGGCACCTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTA
GAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCCGTTTTCGGTGCCATCAGTGCCCCG
TCTACAGCTCCCCCAGCTCCCCCCACCTCCCCCACTCCCAACCACGTTGGGACAGGGAGG
TGTGAGGCAGGAGAGACAGTTGGATTCTTTAGAGAAGATGGATATGACCAGTGGCTATGG
CCTGTGCGATCCCACCCGTGGTGGCTCAAGTCTGGCCCCACACCAGCCCCAATCCAAAAC
TGGCAAGGACGCTTCACAGGACAGGAAAGTGGCACCTGTCTGCTCCAGCTCTGGCATGGC
TAGGAGGGGGGAGTCCCTTGAACTACTGGGTGTAGACTGGCCTGAACCACAGGAGAGGAT
GGCCCAGGGTGAGGTGGCATGGTCCATTCTCAAGGGACGTCCTCCAACGGGTGGCGCTAG
AGGCCATGGAGGCAGTAGGACAAGGTGCAGGCAGGCTGGCCTGGGGTCAGGCCGGGCAGA
GCACAGCGGGGTGAGAGGGATTCCTAATCACTCAGAGCAGTCTGTGACTTAGTGGACAGG
GGAGGGGGCAAAGGGGGAGGAGAAGAAAATGTTCTTCCAGTTACTTTCCAATTCTCCTTT
AGGGACAGCTTAGAATTATTTGCACTATTGAGTCTTCATGTTCCCACTTCAAAACAAACA
GATGCTCTGAGAGCAAACTGGCTTGAATTGGTGACATTTAGTCCCTCAAGCCACCAGATG
TGACAGTGTTGAGAACTACCTGGATTTGTATATATACCTGCGCTTGTTTTAAAGTGGGCT
CAGCACATAGGGTTCCCACGAAGCTCCGAAACTCTAAGTGTTTGCTGCAATTTTATAAGG
ACTTCCTGATTGGTTTCTCTTCTCCCCTTCCATTTCTGCCTTTTGTTCATTTCATCCTTT
CACTTCTTTCCCTTCCTCCATCCTCCTCCTTCCTAGTTCATCCCTTCTCTTCCAGGCAGC
CGCGGTGCCCAACCACACTTGTCGGCTCCAGTCCCCAGAACTCTGCCTGCCCTTTGTCCT
CCTGCTGCCAGTACCAGCCCCACCCTGTTTTGAGCCCTGAGGAGGCCTTGGGCTCTGCTG
AGTCCGACCTGGCCTGTCTGTGAAGAGCAAGAGAGCAGCAAGGTCTTGCTCTCCTAGGTA
GCCCCCTCTTCCCTGGTAAGAAAAAGCAAAAGGCATTTCCCACCCTGAACAACGAGCCTT
TTCACCCTTCTACTCTAGAGAAGTGGACTGGAGGAGCTGGGCCCGATTTGGTAGTTGAGG
AAAGCACAGAGGCCTCCTGTGGCCTGCCAGTCATCGAGTGGCCCAACAGGGGCTCCATGC
CAGCCGACCTTGACCTCACTCAGAAGTCCAGAGTCTAGCGTAGTGCAGCAGGGCAGTAGC
GGTACCAATGCAGAACTCCCAAGACCCGAGCTGGGACCAGTACCTGGGTCCCCAGCCCTT
CCTCTGCTCCCCCTTTTCCCTCGGAGTTCTTCTTGAATGGCAATGTTTTGCTTTTGCTCG
ATGCAGACAGGGGGCCAGAACACCACACATTTCACTGTCTGTCTGGTCCATAGCTGTGGT
GTAGGGGCTTAGAGGCATGGGCTTGCTGTGGGTTTTTAATTGATCAGTTTTCATGTGGGA
TCCCATCTTTTTAACCTCTGTTCAGGAAGTCCTTATCTAGCTGCATATCTTCATCATATT
GGTATATCCTTTTCTGTGTTTACAGAGATGTCTCTTATATCTAAATCTGTCCAACTGAGA
AGTACCTTATCAAAGTAGCAAATGAGACAGCAGTCTTATGCTTCCAGAAACACCCACAGG
CATGTCCCATGTGAGCTGCTGCCATGAACTGTCAAGTGTGTGTTGTCTTGTGTATTTCAG
TTATTGTCCCTGGCTTCCTTACTATGGTGTAATCATGAAGGAGTGAAACATCATAGAAAC
TGTCTAGCACTTCCTTGCCAGTCTTTAGTGATCAGGAACCATAGTTGACAGTTCCAATCA
GTAGCTTAAGAAAAAACCGTGTTTGTCTCTTCTGGAATGGTTAGAAGTGAGGGAGTTTGC
CCCGTTCTGTTTGTAGAGTCTCATAGTTGGACTTTCTAGCATATATGTGTCCATTTCCTT
ATGCTGTAAAAGCAAGTCCTGCAACCAAACTCCCATCAGCCCAATCCCTGATCCCTGATC
CCTTCCACCTGCTCTGCTGATGACCCCCCCAGCTTCACTTCTGACTCTTCCCCAGGAAGG
GAAGGGGGGTCAGAAGAGAGGGTGAGTCCTCCAGAACTCTTCCTCCAAGGACAGAAGGCT
CCTGCCCCCATAGTGGCCTCGAACTCCTGGCACTACCAAAGGACACTTATCCACGAGAGC
GCAGCATCCGACCAGGTTGTCACTGAGAAGATGTTTATTTTGGTCAGTTGGGTTTTTATG
TATTATACTTAGTCAAATGTAATGTGGCTTCTGGAATCATTGTCCAGAGCTGCTTCCCCG
TCACCTGGGCGTCATCTGGTCCTGGTAAGAGGAGTGCGTGGCCCACCAGGCCCCCCTGTC
ACCCATGACAGTTCATTCAGGGCCGATGGGGCAGTCGTGGTTGGGAACACAGCATTTCAA
GCGTCACTTTATTTCATTCGGGCCCCACCTGCAGCTCCCTCAAAGAGGCAGTTGCCCAGC
CTCTTTCCCTTCCAGTTTATTCCAGAGCTGCCAGTGGGGCCTGAGGCTCCTTAGGGTTTT
CTCTCTATTTCCCCCTTTCTTCCTCATTCCCTCGTCTTTCCCAAAGGCATCACGAGTCAG
TCGCCTTTCAGCAGGCAGCCTTGGCGGTTTATCGCCCTGGCAGGCAGGGGCCCTGCAGCT
CTCATGCTGCCCCTGCCTTGGGGTCAGGTTGACAGGAGGTTGGAGGGAAAGCCTTAAGCT
GCAGGATTCTCACCAGCTGTGTCCGGCCCAGTTTTGGGGTGTGACCTCAATTTCAATTTT
GTCTGTACTTGAACATTATGAAGATGGGGGCCTCTTTCAGTGAATTTGTGAACAGCAGAA
TTGACCGACAGCTTTCCAGTACCCATGGGGCTAGGTCATTAAGGCCACATCCACAGTCTC
CCCCACCCTTGTTCCAGTTGTTAGTTACTACCTCCTCTCCTGACAATACTGTATGTCGTC
GAGCTCCCCCCAGGTCTACCCCTCCCGGCCCTGCCTGCTGGTGGGCTTGTCATAGCCAGT
GGGATTGCCGGTCTTGACAGCTCAGTGAGCTGGAGATACTTGGTCACAGCCAGGCGCTAG
CACAGCTCCCTTCTGTTGATGCTGTATTCCCATATCAAAAGACACAGGGGACACCCAGAA
ACGCCACATCCCCCAATCCATCAGTGCCAAACTAGCCAACGGCCCCAGCTTCTCAGCTCG
CTGGATGGCGGAAGCTGCTACTCGTGAGCGCCAGTGCGGGTGCAGACAATCTTCTGTTGG
GTGGCATCATTCCAGGCCCGAAGCATGAACAGTGCACCTGGGACAGGGAGCAGCCCCAAA
TTGTCACCTGCTTCTCTGCCCAGCTTTTCATTGCTGTGACAGTGATGGCGAAAGAGGGTA
ATAACCAGACACAAACTGCCAAGTTGGGTGGAGAAAGGAGTTTCTTTAGCTGACAGAATC
TCTGAATTTTAAATCACTTAGTAAGCGGCTCAAGCCCAGGAGGGAGCAGAGGGATACGAG
CGGAGTCCCCTGCGCGGGACCATCTGGAATTGGTTTAGCCCAAGTGGAGCCTGACAGCCA
GAACTCTGTGTCCCCCGTCTAACCACAGCTCCTTTTCCAGAGCATTCCAGTCAGGCTCTC
TGGGCTGACTGGGCCAGGGGAGGTTACAGGTACCAGTTCTTTAAGAAGATCTTTGGGCAT
ATACATTTTTAGCCTGTGTCATTGCCCCAAATGGATTCCTGTTTCAAGTTCACACCTGCA
GATTCTAGGACCTGTGTCCTAGACTTCAGGGAGTCAGCTGTTTCTAGAGTTCCTACCATG
GAGTGGGTCTGGAGGACCTGCCCGGTGGGGGGGCAGAGCCCTGCTCCCTCCGGGTCTTCC
TACTCTTCTCTCTGCTCTGACGGGATTTGTTGATTCTCTCCATTTTGGTGTCTTTCTCTT
TTAGATATTGTATCAATCTTTAGAAAAGGCATAGTCTACTTGTTATAAATCGTTAGGATA
CTGCCTCCCCCAGGGTCTAAAATTACATATTAGAGGGGAAAAGCTGAACACTGAAGTCAG
TTCTCAACAATTTAGAAGGAAAACCTAGAAAACATTTGGCAGAAAATTACATTTCGATGT
TTTTGAATGAATACGAGCAAGCTTTTACAACAGTGCTGATCTAAAAATACTTAGCACTTG
GCCTGAGATGCCTGGTGAGCATTACAGGCAAGGGGAATCTGGAGGTAGCCGACCTGAGGA
CATGGCTTCTGAACCTGTCTTTTGGGAGTGGTATGGAAGGTGGAGCGTTCACCAGTGACC
TGGAAGGCCCAGCACCACCCTCCTTCCCACTCTTCTCATCTTGACAGAGCCTGCCCCAGC
GCTGACGTGTCAGGAAAACACCCAGGGAACTAGGAAGGCACTTCTGCCTGAGGGGCAGCC
TGCCTTGCCCACTCCTGCTCTGCTCGCCTCGGATCAGCTGAGCCTTCTGAGCTGGCCTCT
CACTGCCTCCCCAAGGCCCCCTGCCTGCCCTGTCAGGAGGCAGAAGGAAGCAGGTGTGAG
GGCAGTGCAAGGAGGGAGCACAACCCCCAGCTCCCGCTCCGGGCTCCGACTTGTGCACAG
GCAGAGCCCAGACCCTGGAGGAAATCCTACCTTTGAATTCAAGAACATTTGGGGAATTTG
GAAATCTCTTTGCCCCCAAACCCCCATTCTGTCCTACCTTTAATCAGGTCCTGCTCAGCA
GTGAGAGCAGATGAGGTGAAAAGGCCAAGAGGTTTGGCTCCTGCCCACTGATAGCCCCTC
TCCCCGCAGTGTTTGTGTGTCAAGTGGCAAAGCTGTTCTTCCTGGTGACCCTGATTATAT
CCAGTAACACATAGACTGTGCGCATAGGCCTGCTTTGTCTCCTCTATCCTGGGCTTTTGT
TTTGCTTTTTAGTTTTGCTTTTAGTTTTTCTGTCCCTTTTATTTAACGCACCGACTAGAC
ACACAAAGCAGTTGAATTTTTATATATATATCTGTATATTGCACAATTATAAACTCATTT
TGCTTGTGGCTCCACACACACAAAAAAAGACCTGTTAAAATTATACCTGTTGCTTAATTA
CAATATTTCTGATAACCATAGCATAGGACAAGGGAAAATAAAAAAAGAAAAAAAAGAAAA
AAAAACGACAAATCTGTCTGCTGGTCACTTCTTCTGTCCAAGCAGATTCGTGGTCTTTTC
CTCGCTTCTTTCAAGGGCTTTCCTGTGCCAGGTGAAGGAGGCTCCAGGCAGCACCCAGGT
TTTGCACTCTTGTTTCTCCCGTGCTTGTGAAAGAGGTCCCAAGGTTCTGGGTGCAGGAGC
GCTCCCTTGACCTGCTGAAGTCCGGAACGTAGTCGGCACAGCCTGGTCGCCTTCCACCTC
TGGGAGCTGGAGTCCACTGGGGTGGCCTGACTCCCCCAGTCCCCTTCCCGTGACCTGGTC
AGGGTGAGCCCATGTGGAGTCAGCCTCGCAGGCCTCCCTGCCAGTAGGGTCCGAGTGTGT
TTCATCCTTCCCACTCTGTCGAGCCTGGGGGCTGGAGCGGAGACGGGAGGCCTGGCCTGT
CTCGGAACCTGTGAGCTGCACCAGGTAGAACGCCAGGGACCCCAGAATCATGTGCGTCAG
TCCAAGGGGTCCCCTCCAGGAGTAGTGAAGACTCCAGAAATGTCCCTTTCTTCTCCCCCA
TCCTACGAGTAATTGCATTTGCTTTTGTAATTCTTAATGAGCAATATCTGCTAGAGAGTT
TAGCTGTAACAGTTCTTTTTGATCATCTTTTTTTAATAATTAGAAACACCAAAAAAATCC
AGAAACTTGTTCTTCCAAAGCAGAGAGCATTATAATCACCAGGGCCAAAAGCTTCCCTCC
CTGCTGTCATTGCTTCTTCTGAGGCCTGAATCCAAAAGAAAAACAGCCATAGGCCCTTTC
AGTGGCCGGGCTACCCGTGAGCCCTTCGGAGGACCAGGGCTGGGGCAGCCTCTGGGCCCA
CATCCGGGGCCAGCTCCGGCGTGTGTTCAGTGTTAGCAGTGGGTCATGATGCTCTTTCCC
ACCCAGCCTGGGATAGGGGCAGAGGAGGCGAGGAGGCCGTTGCCGCTGATGTTTGGCCGT
GAACAGGTGGGTGTCTGCGTGCGTCCACGTGCGTGTTTTCTGACTGACATGAAATCGACG
CCCGAGTTAGCCTCACCCGGTGACCTCTAGCCCTGCCCGGATGGAGCGGGGCCCACCCGG
TTCAGTGTTTCTGGGGAGCTGGACAGTGGAGTGCAAAAGGCTTGCAGAACTTGAAGCCTG
CTCCTTCCCTTGCTACCACGGCCTCCTTTCCGTTTGATTTGTCACTGCTTCAATCAATAA
CAGCCGCTCCAGAGTCAGTAGTCAATGAATATATGACCAAATATCACCAGGACTGTTACT
CAATGTGTGCCGAGCCCTTGCCCATGCTGGGCTCCCGTGTATCTGGACACTGTAACGTGT
GCTGTGTTTGCTCCCCTTCCCCTTCCTTCTTTGCCCTTTACTTGTCTTTCTGGGGTTTTT
CTGTTTGGGTTTGGTTTGGTTTTTATTTCTCCTTTTGTGTTCCAAACATGAGGTTCTCTC
TACTGGTCCTCTTAACTGTGGTGTTGAGGCTTATATTTGTGTAATTTTTGGTGGGTGAAA
GGAATTTTGCTAAGTAAATCTCTTCTGTGTTTGAACTGAAGTCTGTATTGTAACTATGTT
TAAAGTAATTGTTCCAGAGACAAATATTTCTAGACACTTTTTCTTTACAAACAAAAGCAT
TCGGAGGGAGGGGGATGGTGACTGAGATGAGAGGGGAGAGCTGAACAGATGACCCCTGCC
CAGATCAGCCAGAAGCCACCCAAAGCAGTGGAGCCCAGGAGTCCCACTCCAAGCCAGCAA
GCCGAATAGCTGATGTGTTGCCACTTTCCAAGTCACTGCAAAACCAGGTTTTGTTCCGCC
CAGTGGATTCTTGTTTTGCTTCCCCTCCCCCCGAGATTATTACCACCATCCCGTGCTTTT
AAGGAAAGGCAAGATTGATGTTTCCTTGAGGGGAGCCAGGAGGGGATGTGTGTGTGCAGA
GCTGAAGAGCTGGGGAGAATGGGGCTGGGCCCACCCAAGCAGGAGGCTGGGACGCTCTGC
TGTGGGCACAGGTCAGGCTAATGTTGGCAGATGCAGCTCTTCCTGGACAGGCCAGGTGGT
GGGCATTCTCTCTCCAAGGTGTGCCCCGTGGGCATTACTGTTTAAGACACTTCCGTCACA
TCCCACCCCATCCTCCAGGGCTCAACACTGTGACATCTCTATTCCCCACCCTCCCCTTCC
CAGGGCAATAAAATGACCATGGAGGGGGCTTGCACTCTCTTGGCTGTCACCCGATCGCCA
GCAAAACTTAGATGTGAGAAAACCCCTTCCCATTCCATGGCGAAAACATCTCCTTAGAAA
AGCCATTACCCTCATTAGGCATGGTTTTGGGCTCCCAAAACACCTGACAGCCCCTCCCTC
CTCTGAGAGGCGGAGAGTGCTGACTGTAGTGACCATTGCATGCCGGGTGCAGCATCTGGA
AGAGCTAGGCAGGGTGTCTGCCCCCTCCTGAGTTGAAGTCATGCTCCCCTGTGCCAGCCC
AGAGGCCGAGAGCTATGGACAGCATTGCCAGTAACACAGGCCACCCTGTGCAGAAGGGAG
CTGGCTCCAGCCTGGAAACCTGTCTGAGGTTGGGAGAGGTGCACTTGGGGCACAGGGAGA
GGCCGGGACACACTTAGCTGGAGATGTCTCTAAAAGCCCTGTATCGTATTCACCTTCAGT
TTTTGTGTTTTGGGACAATTACTTTAGAAAATAAGTAGGTCGTTTTAAAAACAAAAATTA
TTGATTGCTTTTTTGTAGTGTTCAGAAAAAAGGTTCTTTGTGTATAGCCAAATGACTGAA
AGCACTGATATATTTAAAAACAAAAGGCAATTTATTAAGGAAATTTGTACCATTTCAGTA
AACCTGTCTGAATGTACCTGTATACGTTTCAAAAACACCCCCCCCCCACTGAATCCCTGT
AACCTATTTATTATATAAAGAGTTTGCCTTATAAATTT
acataaaaatgtccgtttgtgtcttttgttgtaaaaatcaagtgattttttcataaggtt
cttttactattggaaaagatgggcagcacgcagttttattttatttttgtaagtttttta
atacatgtgaaagcaaagaatactcagcatgcctttctaagtgacgcgtttgcacctttt