Gene MAGEH1 Variant 1
DNA : 1.46 KbNT_011630
mRNA : 1461 bp NM_014061
CDS : 660 bp NP_054780
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1461 bp
aggctgaaaatacagaaactttaagctatttttttctcttctgcaaactccaggcccctc
caatctctagctgtcatttctgcccttgtcccacccctgtcgctgcctgccccttttcct
atctgctagcggaagtccctgtggaggaccagcctacttcctctttggtgctaggagtgt
GCGTGGCAGGAGAGGCGGGGCCAATTTTGCTGAGCTTTCTCGCGGGCTTGCAGCTGCGGC
AAGTGCTGGCGGCGGCTGCTCGCGCAAGTCAGCTGGCGTGGGAACTACCCTTTGTAGCTG
AGAACGGCTTGTTTATTGCTACAAAGACTCTATTGACATTGGTAGCTTCAGCGGCAGCAG
CTTCTTACGGTATAAAGCTGTTGCTTCCTGAAGAGGCTACAAGCATCCTTCCCTAGGACT
GCTGTAAGCTTTGAGCCTCTAGCAGGAGACATGCCTCGGGGACGAAAGAGTCGGCGCCGC
CGTAATGCGAGAGCCGCAGAAGAGAACCGCAACAATCGCAAAATCCAGGCCTCAGAGGCC
TCCGAGACCCCTATGGCCGCCTCTGTGGTAGCGAGCACCCCCGAAGACGACCTGAGCGGC
CCCGAGGAAGACCCGAGCACTCCAGAGGAGGCCTCTACCACCCCTGAAGAAGCCTCGAGC
ACTGCCCAAGCACAAAAGCCTTCAGTGCCCCGGAGCAATTTTCAGGGCACCAAGAAAAGT
CTCCTGATGTCTATATTAGCGCTCATCTTCATCATGGGCAACAGCGCCAAGGAAGCTCTG
GTCTGGAAAGTGCTGGGGAAGTTAGGAATGCAGCCTGGACGTCAGCACAGCATCTTTGGA
GATCCGAAGAAGATCGTCACAGAAGAGTTTGTGCGCAGAGGGTACCTGATTTATAAACCG
GTGCCCCGTAGCAGTCCGGTGGAGTATGAGTTCTTCTGGGGGCCCCGAGCACACGTGGAA
TCGAGCAAACTGAAAGTCATGCATTTTGTGGCAAGGGTTCGTAACCGATGCTCTAAAGAC
TGGCCTTGTAATTATGACTGGGATTCGGACGATGATGCAGAGGTTGAGGCTATCCTCAAT
TCAGGTGCTAGGGGTTATTCCGCCCCTTAAGTAGATCTGAGGCAGACCCTTGGGGGTGTA
AAAGAGAGTCACAGGTACCCCAAGGAGTAGATGCCAGGGTCCTAAGTTGAAAATGATGTC
GATTGGGGGCGGGGGACACTGTATTTGATATTTGTGATCAGTGATCATTGTTCAACTGCG
AAATAGAGTGTTTGCTTTTGATAATGGAAAATTGTATTCGTTTTAAAATTCCGTTTGTTG
AGAATAACAATATGTTTAAAAATATAATTGAACAAATTTTTTTCTTTGTTTCCTGTCATT
GACATTTAGTATAACAGTTTTGCTAACGTTCTAAAATGAAGTCGTTCCATCATAATCTAT
GATCTTGTACAGCACTTATAGAAATAAGCTGTTCTTTTGAAGTTGAAATACCCAGTAAAA
TGTTGAAGAAGGATGGAGGATTTCTTCATATCTGACGTTTCTGAAACCCTTTGTGTCTGC
TGTTGTGTGAAGATTGACATTTACCATGATTTTCCTTAGTTACTGCAGAACATAGAGAAA
AATAAAAGCCTAACGAATAGT
acatcttgcgcattttctgaccacctgttatgtgaggcaccagtctagattctagggata
ctccctagtacacatcctccaggtccaaagaatgttctagattatgtgggaaagaaaaat
aggtaaactggcagtgcagtaaatgctgggatagagaacgagcctgaagtgccatgaaaa