Gene MAGED2 Variant 2
DNA : 7.65 KbNT_011630
mRNA : 2060 bp NM_014599
CDS : 1821 bp NP_055414
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  70 bp
aaggaattctggagtaaataggaaatgtgaggtaggaatagggagtagggagccaggcta
agggaatacggaggggggcataaggaatgaggagcagggagcgggggaggggcagacagg
ctgggacggaggccccctagggaggcggaaaggggcgggaccacttccggcctagagagg
GGAGGGCAGTCTCCGAGTTTCGGAGGGGCTTGGAGTGAGTGGACGCACTCGGGAATTGTA
GGAGGACGAG
gtgagcagccgggtcggcttttggatgagagccccgctaggggtcggccccaccctctgg
gatctggagaaaacctgccttaaggaccggatcgtaccggatccatccggctgggaaggg
aggggactggacccggtttggccgggcccaagatggaatcactagctcagtatttatttg
EXON 2  74 bp
gcggctgcagagaattgagacttagaagctttgaattcctgtatctgagaacggagtcgt
tgggggtggtggagggggttggaattggggacctacggaaggtgaggatcagcctccagg
cacaacaggggagaggacgttcagtgggcttcaacttgacccaggccttctccccttcag
GCTCAGCTCTTGCCAGGCCAAATTGAGACATGTCTGACACAAGCGAGAGTGGTGCAGGTC
TAACTCGCTTCCAG
gtaaggcctctttctgtcctttccccagctgcttttcctctccagcccttgttgctgccc
ccaagtcccttggctcttcccctcccatccttgtccttctccacctactttcctgcctgg
gtgtccccctgcccagtggagggagggagagaaggtgggcgggcccctcttctgccatca
EXON 3  492 bp
cctcttctgccatcagttcttgctcagaggaaagggaggccttgttgggctgaggtggtc
agagcacaccgcaggtaggagtcagtacaggtcagagaagtgtggccttggaattttgga
gccatttgcttagttgggggtgaggagaaggtctatgaacttccctgcttcctcttgcag
GCTGAAGCTTCAGAAAAGGACAGTAGCTCGATGATGCAGACTCTGTTGACAGTGACCCAG
AATGTGGAGGTCCCAGAGACACCGAAGGCCTCAAAGGCACTGGAGGTCTCAGAGGATGTG
AAGGTCTCAAAAGCCTCTGGGGTCTCAAAGGCCACAGAGGTCTCAAAGACCCCAGAGGCT
CGGGAGGCACCTGCCACCCAGGCCTCATCTACTACTCAGCTGACTGATACCCAGGTTCTG
GCAGCTGAAAACAAGAGTCTAGCAGCTGACACCAAGAAACAGAATGCTGACCCGCAGGCT
GTGACAATGCCTGCCACTGAGACCAAAAAGGTCAGCCATGTGGCTGATACAAAGGTCAAT
ACAAAGGCTCAGGAGACTGAGGCTGCACCCTCTCAGGCCCCAGCAGATGAACCTGAGCCT
GAGAGTGCAGCTGCCCAGTCTCAGGAGAATCAGGATACTCGGCCCAAGGTCAAAGCCAAG
AAAGCCCGAAAG
gtaagacctctgcagtcaccacccttggttttctactcctctctcagttgattcatttgt
tctacaaacatttagaaagatccctgtgctcatcagggctgtggggggcactgagagtaa
tgtgatgtaattcctgtcttcagagagcttgcagactgatggggaggtgcaatctgaatg
EXON 4  309 bp
atgaaacacctgcttggaagtcagtgagaaacaaatccagggttcagcatggccaacatc
tattgagtcaggctgttactacaggggtgggattagcgggtgcttcctggaagagatagg
gagaggaaaaggaccacttgcttcatctggtgacgttgagcttcctctctgttgatgcag
GTGAAGCATCTGGATGGGGAAGAGGATGGCAGCAGTGATCAGAGTCAGGCTTCTGGAACC
ACAGGTGGCCGAAGGGTCTCAAAGGCCCTAATGGCCTCAATGGCCCGCAGGGCTTCAAGG
GGTCCCATAGCCTTTTGGGCCCGCAGGGCATCAAGGACTCGGTTGGCTGCTTGGGCCCGG
AGAGCCTTGCTCTCCCTGAGATCACCTAAAGCCCGTAGGGGCAAGGCTCGCCGTAGAGCT
GCCAAGCTCCAGTCATCCCAAGAGCCTGAAGCACCACCACCTCGGGATGTGGCCCTTTTG
CAAGGGAGG
gtaagaactctgtcgtttttattctgccttttctactgccttggctgtccttttctttgc
catcgtctcaagttttctgcaaacttgttttggtctttccatctttttctactctgccag
gcaaatgatttggtgaagtaccttttggctaaagaccagacgaagattcccatcaagcgc
EXON 5  64 bp
cagtcatcccaagagcctgaagcaccaccacctcgggatgtggcccttttgcaagggagg
gtaagaactctgtcgtttttattctgccttttctactgccttggctgtccttttctttgc
catcgtctcaagttttctgcaaacttgttttggtctttccatctttttctactctgccag
GCAAATGATTTGGTGAAGTACCTTTTGGCTAAAGACCAGACGAAGATTCCCATCAAGCGC
TCGG
gtaaagtcctaccaatcctccctctgccctgagctctgccctccattgcccttacaccat
tgtgctggggatatcccctgctcttatgcttatgtctctgtcctcccaaagttctgattt
ggcagtgctagcatctctgttgataagcacagaaccgggttatgccacccttggtgtggt
EXON 6  80 bp
ctcttatgcttatgtctctgtcctcccaaagttctgatttggcagtgctagcatctctgt
tgataagcacagaaccgggttatgccacccttggtgtggttggcaaagagtctatagctt
gggcatcagggccacctggcatctcttcagtcaggtgctcacaacactctccccttgcag
ACATGCTGAAGGACATCATCAAAGAATACACTGATGTGTACCCCGAAATCATTGAACGAG
CAGGCTATTCCTTGGAGAAG
gtgaaggggcagccctgggggatgggcacagtggggaagccttgaattgaacaaaaatgt
acaagtcccttctcgggaaccaaagagacctgctaatccagctccatcgctatgctgagg
ggcagacagtggcctagggaggggtgtagattagcgatgggtcacacagcaagtcaatgg
EXON 7  95 bp
tgatgatgacaatagtacatttgcagcgtgtttaccgggtgccaggcacttagctatgta
ctttgtgcgtattatctcactgatttctcacacatgcgaaactcctaggtacatagggag
ctgcagcatgccccggaagctgaattttgtcatctcacaagctgttctccccatccacag
GTATTTGGGATTCAATTGAAGGAAATTGATAAGAATGACCACTTGTACATTCTTCTCAGC
ACCTTAGAGCCCACTGATGCAGGCATACTGGGAAC
gtaagctgggaaagggctgaggtgtggggggcttctgctttggccatgtgctgctactcc
tcctttgtcctacttcccccatcctcttagagagtcaggaaagacagggtctcaaaagcc
ccgtcccagttcctatgcatagttggagccctgcttacagtggtggcacctgattatgat
EXON 8  80 bp
agagtagactgaggcttgcaagtctaagtgccttgccaagggtggcatagagctggaagc
agagactgggtagaattctgtatctgaggaatctgggagaggctagcctagtgagttggc
tggtgtgtctgttgcagatggctgctgaacataaacctctctgtcctgttatttctctag
GACTAAGGACTCACCCAAGCTGGGTCTGCTCATGGTGCTTCTTAGCATCATCTTCATGAA
TGGAAATCGGTCCAGTGAGG
gtgagtggctgggcttgcagctgaatgggtggctgtggtctagattccatgtgttcaatt
tctgtccctgtctcctcttgcctcccctcgcagctgtcatctgggaggtgctgcgcaagt
tggggctgcgccctgggtatgattgggctctctcagcgcttgctgtccgtgttgtccttt
EXON 9  43 bp
tctctaggactaaggactcacccaagctgggtctgctcatggtgcttcttagcatcatct
tcatgaatggaaatcggtccagtgagggtgagtggctgggcttgcagctgaatgggtggc
tgtggtctagattccatgtgttcaatttctgtccctgtctcctcttgcctcccctcgcag
CTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGG
gtatgattgggctctctcagcgcttgctgtccgtgttgtcctttggcaagagaggacggt
cctaggattgcatcagtctggtggtctggtggagcgggtggggtgctggactgggtagag
ggcccagggttctgacctgggtggatgatgggtgaatggtcctgaactctctgctccctc
EXON 10  63 bp
atgggtgaatggtcctgaactctctgctccctctctcagtgtctcttgggcttctatgga
gcttccctcttgtgctggaaacctcttttccatcttggaaatgcctctgcccacatctgg
gaagtgccatagccttgagtgaatttatttgtttatttatttttctttttcttctctcag
GATACATCATTCACTCTTTGGGGACGTGAAGAAGCTCATCACTGATGAGTTTGTGAAGCA
GAA
gtaagtatctctgtctggtgttcatgtgtcccatgcatttggcctatttcagaactgagt
gataaagccgtggtgcatggatgcatgtgtctatgtgtgtatgtatttgcatatttgcat
gtatgcaggtgggattattccttgggcggtgatgggaaacaggagcagcacatgtttcct
EXON 11  115 bp
acaaacgtcccccaacacctctatgtggcttctgggcaagaccagtgggacagggctcaa
tattggaagaaagactgtagtaattagtggatgatgttgccatctggagcctgtccagtc
tatgcatgggtaggccatgaatggtcttagaaataaaggctttgaacctctctttccaag
GTACCTGGACTATGCCAGAGTCCCCAATAGCAATCCCCCTGAATATGAGTTCTTCTGGGG
CCTGCGCTCTTACTATGAGACCAGCAAGATGAAAGTCCTCAAGTTTGCCTGCAAG
gtaattggagagctccttgagcttggcaagtcaagagcatggggtgcccctggctggggc
aggctgtgtgcagagcagcctgcagttcaaatctgaatgttttggtgcttctgttaattg
tcaaaacactgtaacaggcactttatctgaatcatttaagccttacaacctgatatgtca
EXON 12  443 bp
actggtaatactgtattattactattatctttttatactaagcatgtagcatagtgccta
gcataaaggtagatgcttaatcctcttatgctccttctgatggttatttacatagtaata
ctgtattattactatggcttaatccctctatgctccttctgatggttatttttgtttcag
GTACAAAAGAAGGATCCCAAGGAATGGGCAGCTCAGTACCGAGAGGCGATGGAAGCGGAT
TTGAAGGCTGCAGCTGAGGCTGCAGCTGAAGCCAAGGCTAGGGCCGAGATTAGAGCTCGA
ATGGGCATTGGGCTCGGCTCGGAGAATGCTGCCGGGCCCTGCAACTGGGACGAAGCTGAT
ATCGGACCCTGGGCCAAAGCCCGGATCCAGGCGGGAGCAGAAGCTAAAGCCAAAGCCCAA
GAGAGTGGCAGTGCCAGCACTGGTGCCAGTACCAGTACCAATAACAGTGCCAGTGCCAGT
GCCAGCACCAGTGGTGGCTTCAGTGCTGGTGCCAGCCTGACCGCCACTCTCACATTTGGG
CTCTTCGCTGGCCTTGGTGGAGCTGGTGCCAGCACCAGTGGCAGCTCTGGTGCCTGTGGT
TTCTCCTACAAGTGAGATTTTAG
gtatctgccttggtttcagtggggacatctggggcttatggggctgggatgaggagctgg
atgattctaggaaggcccaagttggagaatgatgtggagagtgtgccaagacactgcttt
tggcattttattcctttctgtttgctggatgtcaattgacccttttattttctcttactt
EXON 13  132 bp
tggtttcagtggggacatctggggcttatggggctgggatgaggagctggatgattctag
gaaggcccaagttggagaatgatgtggagagtgtgccaagacactgcttttggcatttta
ttcctttctgtttgctggatgtcaattgacccttttattttctcttacttgtgttttcag
ATATTGTTAATCCTGCCAGTCTTTCTCTTCAAGCCAGGGTGCATCCTCAGAAACCTACTC
AACACAGCACTCTAGGCAGCCACTATCAATCAATTGAAGTTGACACTCTGCATTAAATCT
ATTTGCCATTTC
tgagtttattgctttttttggcgggctgtcacattttggtatcacatttaaaaatcagtg
agttgggaaagtttccacctcagtctgtgtttagtttgaggtgatattgttggattccca
ggagcgagattaacacacctttctgggatagattgggcctcacgtctaattgttggattc