Gene MAGEA3 Variant 1
DNA : 3.59 KbNT_011726
mRNA : 1723 bp NM_005362
CDS : 945 bp NP_005353
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  78 bp
agcctcaggacccccgtcccaatccttaccccttgccccatcaccatcttcatgcttacc
tccacccccatccgatccccatccaggcagaatccagttccacccctgcccggaacccag
ggtagtaccgttgccaggatgtgacgccactgacttgcgcattggaggtcagaagaccgc
GAGATTCTCGCCCTGAGCAACGAGCGACGGCCTGACGTCGGCGGAGGGAAGCCGGCCCAG
GCTCGGTGAGGAGGCAAG
gtaagacgctgagggaggactgaggcgggcctcacctcagacagagggcctcaaataatc
cagtgctgcctctgctgccgggcctgggccaccccgcaggggaagacttccaggctgggt
cgccactacctcaccccgccgacccccgccgctttagccacggggaactctggggacaga
EXON 2  66 bp
gagggggctcagatagtgccaacggtgaaggtttgccttggattcaaaccaagggcccca
cctgccccagaacacatggactccagagcgcctggcctcaccctcaatactttcagtcct
gcagcctcagcatgcgctggccggatgtaccctgaggtgccctctcacttcctccttcag
GTTCTGAGGGGACAGGCTGACCTGGAGGACCAGAGGCCCCCGGAGGAGCACTGAAGGAGA
AGATCT
gtaagtaagcctttgttagagcctccaaggttccattcagtactcagctgaggtctctca
catgctccctctctccccaggccagtgggtctccattgcccagctcctgcccacactccc
gcctgttgccctgaccagagtcatcatgcctcttgagcagaggagtcagcactgcaagcc
EXON 3  1579 bp
gtaccctgaggtgccctctcacttcctccttcaggttctgaggggacaggctgacctgga
ggaccagaggcccccggaggagcactgaaggagaagatctgtaagtaagcctttgttaga
gcctccaaggttccattcagtactcagctgaggtctctcacatgctccctctctccccag
GCCAGTGGGTCTCCATTGCCCAGCTCCTGCCCACACTCCCGCCTGTTGCCCTGACCAGAG
TCATCATGCCTCTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAAGAAGGCCTTGAGGCCC
GAGGAGAGGCCCTGGGCCTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGGAGGCTG
CCTCCTCCTCTTCTACTCTAGTTGAAGTCACCCTGGGGGAGGTGCCTGCTGCCGAGTCAC
CAGATCCTCCCCAGAGTCCTCAGGGAGCCTCCAGCCTCCCCACTACCATGAACTACCCTC
TCTGGAGCCAATCCTATGAGGACTCCAGCAACCAAGAAGAGGAGGGGCCAAGCACCTTCC
CTGACCTGGAGTCCGAGTTCCAAGCAGCACTCAGTAGGAAGGTGGCCGAGTTGGTTCATT
TTCTGCTCCTCAAGTATCGAGCCAGGGAGCCGGTCACAAAGGCAGAAATGCTGGGGAGTG
TCGTCGGAAATTGGCAGTATTTCTTTCCTGTGATCTTCAGCAAAGCTTCCAGTTCCTTGC
AGCTGGTCTTTGGCATCGAGCTGATGGAAGTGGACCCCATCGGCCACTTGTACATCTTTG
CCACCTGCCTGGGCCTCTCCTACGATGGCCTGCTGGGTGACAATCAGATCATGCCCAAGG
CAGGCCTCCTGATAATCGTCCTGGCCATAATCGCAAGAGAGGGCGACTGTGCCCCTGAGG
AGAAAATCTGGGAGGAGCTGAGTGTGTTAGAGGTGTTTGAGGGGAGGGAAGACAGTATCT
TGGGGGATCCCAAGAAGCTGCTCACCCAACATTTCGTGCAGGAAAACTACCTGGAGTACC
GGCAGGTCCCCGGCAGTGATCCTGCATGTTATGAATTCCTGTGGGGTCCAAGGGCCCTCG
TTGAAACCAGCTATGTGAAAGTCCTGCACCATATGGTAAAGATCAGTGGAGGACCTCACA
TTTCCTACCCACCCCTGCATGAGTGGGTTTTGAGAGAGGGGGAAGAGTGAGTCTGAGCAC
GAGTTGCAGCCAGGGCCAGTGGGAGGGGGTCTGGGCCAGTGCACCTTCCGGGGCCGCATC
CCTTAGTTTCCACTGCCTCCTGTGACGTGAGGCCCATTCTTCACTCTTTGAAGCGAGCAG
TCAGCATTCTTAGTAGTGGGTTTCTGTTCTGTTGGATGACTTTGAGATTATTCTTTGTTT
CCTGTTGGAGTTGTTCAAATGTTCCTTTTAACGGATGGTTGAATGAGCGTCAGCATCCAG
GTTTATGAATGACAGTAGTCACACATAGTGCTGTTTATATAGTTTAGGAGTAAGAGTCTT
GTTTTTTACTCAAATTGGGAAATCCATTCCATTTTGTGAATTGTGACATAATAATAGCAG
TGGTAAAAGTATTTGCTTAAAATTGTGAGCGAATTAGCAATAACATACATGAGATAACTC
AAGAAATCAAAAGATAGTTGATTCTTGCCTTGTACCTCAATCTATTCTGTAAAATTAAAC
AAATATGCAAACCAGGATTTCCTTGACTTCTTTGAGAATGCAAGCGAAATTAAATCTGAA
TAAATAATTCTTCCTCTTC
actggctcgtttcttttccgttcactcagcatctgctctgtgggaggccctgggttagta
gtggggatgctaaggtaagccagactcacgcctacccatagggctgtagagcctaggacc
tgcagtcatataattaaggtggtgagaagtcctgtaagatgtagaggaaatgtaagagag