Gene IL13RA1 Variant 1
DNA : 66.94 KbNT_077819
mRNA : 4006 bp NM_001560
CDS : 1284 bp NP_001551
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  131 bp
ccgtaggagccgccagagccgccagagccgccggcgccccgccccgcctcctccggccgc
tctcgccggctcaggttacctgaggccggtgggcggggcggcccttcccgtctgcgccgg
cccccagcctccagggcggcggagccgggaagtggaagagggagcgaaggaggcggggac
TGCCAAGGCTCCAGCCCGGCCGGGCTCCGAGGCGAGAGGCTGCATGGAGTGGCCGGCGCG
GCTCTGCGGGCTGTGGGCGCTGCTGCTCTGCGCCGGCGGCGGGGGCGGGGGCGGGGGCGC
CGCGCCTACGG
gtgagtgcgaccctcggggcccgaggggcggccggagggctgagggcggtgagggtcacg
gctgaaaggccccggaggtcaacgccgggcggagggccgaagctggggtgggtgctgggg
gctgccctcgcgaggccccgcgctcggcggctgcggcttcccgcgcgggatctctggggc
EXON 2  140 bp
tgttgtgaggattaaatggattaatatgtgtggaatatttagaatagtccctggcccagt
aaatgttagatgttgttaactcagttattactgtcttgtcctctaggacttgggagaatt
aagcaaaccattaaaaatactgttgataaattcatttttttttgtccttgatttgaacag
AAACTCAGCCACCTGTGACAAATTTGAGTGTCTCTGTTGAAAACCTCTGCACAGTAATAT
GGACATGGAATCCACCCGAGGGAGCCAGCTCAAATTGTAGTCTATGGTATTTTAGTCATT
TTGGCGACAAACAAGATAAG
gtaagttttctgcaacatgttacattgatgaggtaaagtgaacactatgaattggagcca
agaataagccaaattctagtcttacgtcaaagtggaaattgtattttagggtgtgtttaa
atttcagttggggaaattatagaagcaactattgacacaagtgaacacttaaaaatattt
EXON 3  139 bp
tattaccaaatgtctctgagagcggtagggagaacaaaatcagccccaattgagaatcac
tgatctataccatttgataacttttttgataaaaaaagcaccacatttagacatgctaat
gtttcattatataagtgtgtgttagctgaagcaatgcctttttcaattttctaaccttag
AAAATAGCTCCGGAAACTCGTCGTTCAATAGAAGTACCCCTGAATGAGAGGATTTGTCTG
CAAGTGGGGTCCCAGTGTAGCACCAATGAGAGTGAGAAGCCTAGCATTTTGGTTGAAAAA
TGCATCTCACCCCCAGAAG
gtaacaactgaaagcgctatctcttggtgtttagagaataaatctgaatgctccaatgct
tttgtgcattgttcattaattaattcaattctcaaacattttctgagtctaataagtgcc
aggcattgtactaggtgctagcagctcaatgaaaatatgagtatgtctctgccttgaaga
EXON 4  121 bp
aattagatttgagtttcctccatcctgggtgacttctgggtaaaatggggtgagagatga
agcatttgctttctgacaaagcagcatgaagcactctcatcatccccatgccaaagagtg
atttgctactttgcattacaaggaaagaagggtcttaaactcttggcctggatattctag
GTGATCCTGAGTCTGCTGTGACTGAGCTTCAATGCATTTGGCACAACCTGAGCTACATGA
AGTGTTCTTGGCTCCCTGGAAGGAATACCAGTCCCGACACTAACTATACTCTCTACTATT
G
gtgagtatgtacagtacaattactggaagactgattgtaattgtgttgggagcctttgga
tccaacctagtcaaaaaaaaaagaactgtttaattttttctgcaaactcaacaagatgga
cagtttgcttcaatgaaaaatgcatctgtctttggtgtctactttttaaataaactttct
EXON 5  188 bp
gagacagggtttcaccatgttggcaaggctggtttccaactcctgacctcaagtgatccg
cctgcctcagcctccaaaagtgctgggattacaggtgtgagccaccgcgcccagcctgct
cttatttcttgaatactctgttgaatataatgcagaagattgtctcattttatcttgtag
GCACAGAAGCCTGGAAAAAATTCATCAATGTGAAAACATCTTTAGAGAAGGCCAATACTT
TGGTTGTTCCTTTGATCTGACCAAAGTGAAGGATTCCAGTTTTGAACAACACAGTGTCCA
AATAATGGTCAAGGATAATGCAGGAAAAATTAAACCATCCTTCAATATAGTGCCTTTAAC
TTCCCGTG
gtaagttttagaagtcctctaaaacagtatggataaaaagtgtgttatatcttttgcaca
atcaatacaaataataaaaaatgatcattctgggtttaagatcttctgaaagaagggact
atattgatgtataactttctttgatagatcctttttaaagaagtaaacttggaaattctt
EXON 6  152 bp
taaatgagaagaaaaaactctgtacatgttcagcacagatgctattttttaaaaaatatt
ttcagttcatggttggttgaattcatgaatgtggaatccatggatatggagggccgactg
tgtgtttgtgtgtataatcaagctttggaagcttacttgtgttctatttttgtttttcag
TGAAACCTGATCCTCCACATATTAAAAACCTCTCCTTCCACAATGATGACCTATATGTGC
AATGGGAGAATCCACAGAATTTTATTAGCAGATGCCTATTTTATGAAGTAGAAGTCAATA
ACAGCCAAACTGAGACACATAATGTTTTCTAC
gtaaggttttaaaattattgtttttatttggctatttttcttttacttgaatttcttaca
ttgaaatatcaatgaaacatagctcttacatttgtcaccttatgatgatgatggtaatga
aacttcttgtctaaaataaggcatggtggaagatttgaagatttatggtatgatagtatc
EXON 7  48 bp
ttcatatgcatatgtaattgacccagcaccatttattaaaaaaggccaaccttttttcac
tgtacctgatcatcttttaatgggataaaaggaaagcttgttagaaatgactaggtgata
gaaaatgggtttttaaacatttaggactcattagtttatttatttatttttattttcaag
GTCCAAGAGGCTAAATGTGAGAATCCAGAATTTGAGAGAAATGTGGAG
gtcagtaaattcaacattagctatttgggtttagacttagagcagttgggggtggagcat
agcctaaatatgagctgctttgagaaaaacaaattacgttgttccgtgagttattgacaa
ttttttcgaaaagtcaaagataatttgaattgcaatccaagtcttaatcatagacagaat
EXON 8  133 bp
aaacaaattacgttgttccgtgagttattgacaattttttcgaaaagtcaaagataattt
gaattgcaatccaagtcttaatcatagacagaatttggcagataattgtattatgattca
ataacagtgaaaaagaataaactggtaatattccttgtgtatttttattttatgcctaag
AATACATCTTGTTTCATGGTCCCTGGTGTTCTTCCTGATACTTTGAACACAGTCAGAATA
AGAGTCAAAACAAATAAGTTATGCTATGAGGATGACAAACTCTGGAGTAATTGGAGCCAA
GAAATGAGTATAG
gtaagagaacagaatttttattaaaatttaaaacactgatgtataaaaactaagctgaag
cagaaaatagactggggaaagggactgtcatgctctcttgatgtcaggaaaagagtactt
acaattgaaatttattttcttcttaatcactttcaaaccacccagggttaattgacagta
EXON 9  97 bp
gactttttttttttaaactattaatttaacagaagataagataattgaagagcttgggaa
aataggttgggggagggagcagaaatatttgtgatcttactagctaacagaattgctgct
tggtttattactaaaagggttttatttctcaagtctttctgtttgcttttcattctccag
GTAAGAAGCGCAATTCCACACTCTACATAACCATGTTACTCATTGTTCCAGTCATCGTCG
CAGGTGCAATCATAGTACTCCTGCTTTACCTAAAAAG
gtaaggtagctgcccaggcaggttttgcagtttctgatagcctgtttgctgtggttatta
cttttagtgcttgtgttttatgtctgcccagtgtattagaagcatgttgcctgtaagtgg
ctttcgggagtatgacatgacaaggaagtattaccacgcccactttcttttcttttcttt
EXON 10  85 bp
gcccttagaacattgatttttgtgtaccctattttagaaatttcttcacaactgccttgt
caataaagatgacttgtgtaccatgtcttttgtccatgccttcttttaatatggtggtat
ttatgtgggacactcctatggactggaaggtttgaatcaaatgtctctgttttcttaaag
GCTCAAGATTATTATATTCCCTCCAATTCCTGATCCTGGCAAGATTTTTAAAGAAATGTT
TGGAGACCAGAATGATGATACTCTG
gtaagaacagatttcatggggcttgaaatgtttttttttttttttttttttggaagctat
ggcattttttaaaaaagtgtggtaaggtatccataacataaaatttattattttaagcat
ttttaagtatacagttcaggctgggtatggcagctgacgcctgtaatcccaacactttgg
EXON 11  2772 bp
tgtttcattaatcattcagatagataaagattcttaggtcaaaaaaaaaaaaaaaacagg
aaatcatacccctacggttccatccacacaaacctaaaaataagcattggcactaagtac
tcagggaaagaacactgtttagatatgtcattgtgtatgtgtttttttcctcccttctag
CACTGGAAGAAGTACGACATCTATGAGAAGCAAACCAAGGAGGAAACCGACTCTGTAGTG
CTGATAGAAAACCTGAAGAAAGCCTCTCAGTGATGGAGATAATTTATTTTTACCTTCACT
GTGACCTTGAGAAGATTCTTCCCATTCTCCATTTGTTATCTGGGAACTTATTAAATGGAA
ACTGAAACTACTGCACCATTTAAAAACAGGCAGCTCATAAGAGCCACAGGTCTTTATGTT
GAGTCGCGCACCGAAAAACTAAAAATAATGGGCGCTTTGGAGAAGAGTGTGGAGTCATTC
TCATTGAATTATAAAAGCCAGCAGGCTTCAAACTAGGGGACAAAGCAAAAAGTGATGATA
GTGGTGGAGTTAATCTTATCAAGAGTTGTGACAACTTCCTGAGGGATCTATACTTGCTTT
GTGTTCTTTGTGTCAACATGAACAAATTTTATTTGTAGGGGAACTCATTTGGGGTGCAAA
TGCTAATGTCAAACTTGAGTCACAAAGAACATGTAGAAAACAAAATGGATAAAATCTGAT
ATGTATTGTTTGGGATCCTATTGAACCATGTTTGTGGCTATTAAAACTCTTTTAACAGTC
TGGGCTGGGTCCGGTGGCTCACGCCTGTAATCCCAGCAATTTGGGAGTCCGAGGCGGGCG
GATCACTCGAGGTCAGGAGTTCCAGACCAGCCTGACCAAAATGGTGAAACCTCCTCTCTA
CTAAAACTACAAAAATTAACTGGGTGTGGTGGCGCGTGCCTGTAATCCCAGCTACTCGGG
AAGCTGAGGCAGGTGAATTGTTTGAACCTGGGAGGTGGAGGTTGCAGTGAGCAGAGATCA
CACCACTGCACTCTAGCCTGGGTGACAGAGCAAGACTCTGTCTAAAAAACAAAACAAAAC
AAAACAAAACAAAAAAACCTCTTAATATTCTGGAGTCATCATTCCCTTCGACAGCATTTT
CCTCTGCTTTGAAAGCCCCAGAAATCAGTGTTGGCCATGATGACAACTACAGAAAAACCA
GAGGCAGCTTCTTTGCCAAGACCTTTCAAAGCCATTTTAGGCTGTTAGGGGCAGTGGAGG
TAGAATGACTCCTTGGGTATTAGAGTTTCAACCATGAAGTCTCTAACAATGTATTTTCTT
CACCTCTGCTACTCAAGTAGCATTTACTGTGTCTTTGGTTTGTGCTAGGCCCCCGGGTGT
GAAGCACAGACCCCTTCCAGGGGTTTACAGTCTATTTGAGACTCCTCAGTTCTTGCCACT
TTTTTTTTTAATCTCCACCAGTCATTTTTCAGACCTTTTAACTCCTCAATTCCAACACTG
ATTTCCCCTTTTGCATTCTCCCTCCTTCCCTTCCTTGTAGCCTTTTGACTTTCATTGGAA
ATTAGGATGTAAATCTGCTCAGGAGACCTGGAGGAGCAGAGGATAATTAGCATCTCAGGT
TAAGTGTGAGTAATCTGAGAAACAATGACTAATTCTTGCATATTTTGTAACTTCCATGTG
AGGGTTTTCAGCATTGATATTTGTGCATTTTCTAAACAGAGATGAGGTGGTATCTTCACG
TAGAACATTGGTATTCGCTTGAGAAAAAAAGAATAGTTGAACCTATTTCTCTTTCTTTAC
AAGATGGGTCCAGGATTCCTCTTTTCTCTGCCATAAATGATTAATTAAATAGCTTTTGTG
TCTTACATTGGTAGCCAGCCAGCCAAGGCTCTGTTTATGCTTTTGGGGGGCATATATTGG
GTTCCATTCTCACCTATCCACACAACATATCCGTATATATCCCCTCTACTCTTACTTCCC
CCAAATTTAAAGAAGTATGGGAAATGAGAGGCATTTCCCCCACCCCATTTCTCTCCTCAC
ACACAGACTCATATTACTGGTAGGAACTTGAGAACTTTATTTCCAAGTTGTTCAAACATT
TACCAATCATATTAATACAATGATGCTATTTGCAATTCCTGCTCCTAGGGGAGGGGAGAT
AAGAAACCCTCACTCTCTACAGGTTTGGGTACAAGTGGCAACCTGCTTCCATGGCCGTGT
AGAAGCATGGTGCCCTGGCTTCTCTGAGGAAGCTGGGGTTCATGACAATGGCAGATGTAA
AGTTATTCTTGAAGTCAGATTGAGGCTGGGAGACAGCCGTAGTAGATGTTCTACTTTGTT
CTGCTGTTCTCTAGAAAGAATATTTGGTTTTCCTGTATAGGAATGAGATTAATTCCTTTC
CAGGTATTTTATAATTCTGGGAAGCAAAACCCATGCCTCCCCCTAGCCATTTTTACTGTT
ATCCTATTTAGATGGCCATGAAGAGGATGCTGTGAAATTCCCAACAAACATTGATGCTGA
CAGTCATGCAGTCTGGGAGTGGGGAAGTGATCTTTTGTTCCCATCCTCTTCTTTTAGCAG
TAAAATAGCTGAGGGAAAAGGGAGGGAAAAGGAAGTTATGGGAATACCTGTGGTGGTTGT
GATCCCTAGGTCTTGGGAGCTCTTGGAGGTGTCTGTATCAGTGGATTTCCCATCCCCTGT
GGGAAATTAGTAGGCTCATTTACTGTTTTAGGTCTAGCCTATGTGGATTTTTTCCTAACA
TACCTAAGCAAACCCAGTGTCAGGATGGTAATTCTTATTCTTTCGTTCAGTTAAGTTTTT
CCCTTCATCTGGGCACTGAAGGGATATGTGAAACAATGTTAACATTTTTGGTAGTCTTCA
ACCAGGGATTGTTTCTGTTTAACTTCTTATAGGAAAGCTTGAGTAAAATAAATATTGTCT
TTTTGTATGTCA
cccaaatgttttcctttggtcttattttggggaaatggtgggaggtagagaaaattggag
ttaaaagaagaaacattatgaaaaaattccaagccagctattttatcttataatcattca
tcatgagtttctttgatgttctggctgttccggtgtgcctatgttttctgataagggcat