Gene DKC1 Variant 1
DNA : 14.81 KbNT_025965
mRNA : 2455 bp NM_001363
CDS : 1545 bp NP_001354
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  107 bp
caaccaggctgcttgaggctcgaagcgcatgcgcggtctcgccctccgtactggccgagc
cagcaaatcgcattgcgcagacgaccagcgggcgcctcggattccgcccccgggatggcc
ccgcctcctcccgccccgcggcaaggcacgcacagggcagtgcgcgggtgggtgggtcct
AGCAGCGCGGCCTGACGGGACCAAGGCGGCGGGAGTCTGCGGTCGTTCCCTCGGCTGTGG
ACCGGGCGGCACGCACGCGGTGCAGGGTAACATGGCGGATGCGGAAG
gtaagggctgcaggcttccgggccgtgctaactccgggcgactcggggaacgggggtggg
gggatggtatcggggcccgcgcacgcctccctctggttcccgccggcgtgtcggcctctt
caccgcccggccttaagccggccttgtctctcggccctggctccgtggcaagggcgcgag
EXON 2  68 bp
taatcttatgggggccaccatcacatacgcagtctgtacttgcaaaacattatgtggcat
gtgactgtaattgtagacctaaaatccatttcctacctgccctaatttcggtctttattt
taaacccttgtttcatttattcttggggaaaattcccaaatcctgtgtttgtttttttag
TAATTATTTTGCCAAAGAAACATAAGAAGAAAAAGGAGCGGAAGTCATTGCCAGAAGAAG
ATGTAGCC
gtgagtagtaatgtgtttgacttcactttgactaaaaagaaagtttacttaaataacaaa
ctaaaggaaagaagtgtttttaaaggtttccaaggaatgggccagcattggtagtcattg
tgtagattcgaaaaagcactgaaatgacacagccccagacagtccaagtgtccttcaggc
EXON 3  87 bp
catttcacttcccctctgtactcctggttcatttcttctctctctttcccttggaggtcc
cagtgaaaaggcataggaagccttgttttctgtttaaaaggcatacatttccatggcagt
aatggaattgttcaaaatcgggtgggaagtttaataggttatatttctgtcctgtcgaag
GAAATACAACACGCTGAAGAATTTCTTATCAAACCTGAATCCAAAGTTGCTAAGTTGGAC
ACGTCTCAGTGGCCCCTTTTGCTAAAG
gtatgtggttaaaatcgtgcatcagatgaatgcctgcttttacgttatttccaagtgtta
aacaattgattgagaatgcttactgctggcatccttgactttgggaagtgcccactgata
cagtttaaagcaggattccttaaggtatctgaaatgagaaccaagtttttaaaaaattgg
EXON 4  92 bp
gttgtagaacacatgtccccacaatgttaaattgctgagtttgtcaacagttctcagttt
ttgtacttagtccatcttgcagacctatgccagtttgtgggccacatagtggtactgact
ctttttttacatgtgctcacgacatggtattttgttttgtgttgtgtcgttgctttgtag
AATTTTGATAAGCTGAATGTAAGGACAACACACTATACACCTCTTGCATGTGGTTCAAAT
CCTCTGAAGAGAGAGATTGGGGACTATATCAG
gtaagtgttgggaggaggcactgtgcaaacttactttcttttgaaaatgctttcacatca
gctattcaggaaggcagtggcatgccagaatagctttgtcttgaatatataacctgtacc
cgcagtgaattatttttctttttaacttttcagatttgttgtttcactggagcattaaga
EXON 5  185 bp
cttttgaaaatgctttcacatcagctattcaggaaggcagtggcatgccagaatagcttt
gtcttgaatatataacctgtacccgcagtgaattatttttctttttaacttttcagattt
gttgtttcactggagcattaagagtgggtgatacattaattttttttttttccattccag
GACAGGTTTCATTAATCTTGACAAGCCCTCTAACCCCTCTTCCCATGAGGTGGTAGCCTG
GATTCGACGGATACTTCGGGTGGAGAAGACAGGGCACAGTGGTACGCTGGATCCCAAGGT
GACTGGTTGTTTAATCGTGTGCATAGAACGAGCCACTCGCTTGGTGAAGTCACAACAGAG
TGCAG
gtatgtgggagagggagggaaggactggctagagtgaaaagctttctgtatttcccttct
atgttttgtctgctggaaactatttcttcattaagaaaaaaaaaaatcctaaagcaagga
tattgttttggtttctgtgtacgttctgtcccctgccagatcttggtggtccgcgctttt
EXON 6  65 bp
gtgtcttcattctttcccacatcatcaccatgaaatctctcttaatgcaaattttataga
aacacaaggtcaaactgccgcttttcctgctgtgcaaaatgggagtgactgagcatataa
gaaatatggaaaacagaaaactcagtggccacacctgactactcttttgtcatttttcag
GCAAAGAGTATGTGGGGATTGTCCGGCTGCACAATGCTATTGAAGGGGGGACCCAGCTTT
CTAGG
gtaagtctgcaattgtagggaggacaccctttgttgacttggatctctgagcccctaaac
atctggagatgggttagctgtcctgactgactccttttgtccccttttcagtcggctgct
gcagccagcctggaccagtgactgcacatgtacattctgatgaggtgtttgttttcattt
EXON 7  127 bp
gtagggaggacaccctttgttgacttggatctctgagcccctaaacatctggagatgggt
tagctgtcctgactgactccttttgtccccttttcagtcggctgctgcagccagcctgga
ccagtgactgcacatgtacattctgatgaggtgtttgttttcatttgtgtttgttcttag
GCCCTAGAAACTCTGACAGGTGCCTTATTCCAGCGACCCCCACTTATTGCTGCAGTAAAG
AGGCAGCTCCGAGTGAGGACCATCTACGAGAGCAAAATGATTGAATACGATCCTGAAAGA
AGATTAG
gtgagtcattaggcctgtgagtgggtatgaacacattcttcaggattctgttctcttatt
aaaagtagatgcccttgaagttgaagactttctaaaacctgccctacagctgggatattg
tctgtgggcgatagtttttgttatcttttgttgaaaaagtgaacagtgcctagtaaagtg
EXON 8  131 bp
ttacaggcgtgagccaccgtgcctggccagaattacagatctttacagcaaatgcttata
ttttaagaagtgtgtctgtcacctctagtcttggtggctcagatgaaggataactgcatt
tctcaaccagtgatgtatttacagtaggtgctgcttttcttttgtgtgtgtgtatcttag
GAATCTTTTGGGTGAGTTGTGAGGCTGGCACCTACATTCGGACATTATGTGTGCACCTTG
GTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGAGGGTTCGTTCTGGAGTCA
TGAGTGAAAAG
gtatgtgttacggggctagaagttttagagctggttcttaccatctgccagcctttgatg
gcactccacttgcttcatgtcgtgggaaagatgctttccaaagtgttgagttcagtccag
ggcagcttccctgttctgttaattaaactttgggacattaaaatgggctaagggagatga
EXON 9  141 bp
ccgtctcaaaaaaaaaaaaaaaaaaaaaaaaaagatgcctggaagagccaggactgaaga
ggctgaagacataatgagcttggactagtaaacaagtgacattcagttttaggaagtttg
gggtctgatgggctgagatacaaataaactgaattattttcatacatggctgcttttcag
GACCACATGGTGACAATGCATGATGTGCTTGATGCTCAGTGGCTGTATGATAACCACAAG
GATGAGAGTTACCTGCGGCGAGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAA
CGGCTGGTTATGAAAGACAGT
gcagtaagttccgggttaggagtttatatttggaaagaacgtactccaaagatgaggctt
gctctttttattgttttccttgggttttattttatttttttcaagtccaaaccaagtata
ttaatttaaagtaaaagtttaatggtaggcatacttaaaaataaggcacattaggccagg
EXON 10  125 bp
acctatagcacagtgaggtggctcttctgagtaccactcatgccccttgcagctagtggg
ctataagtgtcatccctgtttcctggtgtcaggccccactcccttgttgtcctcctttac
tctggtgtgggagtggggtggagggcagcagctgggccccttacacttggtgccatctct
GCAGGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCTTCGATATGA
GGACGGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAAGGAGAAGCAATCTG
CATGG
gtaagaggggatgtttattttttaaattctaaatgtttgtggttacatactaggtgtata
tatttatggggttcatgagatgttttgatacaggcatgcaatacataataatcacatcat
ggagaatggggcatccatcttaagcatttatcctttgtgttacaaacaatcctattttac
EXON 11  119 bp
ctccttctcataatggagtatttcctccatatgcacatcctgagcaaaggtaaccccaat
taaagtagtagctcagagttttaaaagttttaaagtggcatacaacagtagaattggggc
tcatcaattatcaattctttcacccttcaaataattcttttctttattcaatgcctgtag
CTATTGCATTAATGACCACAGCGGTCATCTCTACCTGCGACCATGGTATAGTAGCCAAGA
TCAAGAGAGTGATCATGGAGAGAGACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAG
gtaagtggtactgggttgcgtgccctgccaggttcttttttttttttttttttttttaaa
tttatttttttattgataattcttgggtgtttctcacagagggggatttggcagggtcat
gggacaatagtggagggaaggtcagcagataaacaagtgaacaaaggtctctggttttcc
EXON 12  104 bp
tgatcttcaacaagtcctgtgtgtgttggagttagtgggcaaattctgaatgctctggag
aggagtttgaggccctgctgagaatacaccagggaggaaccttgttctattctttgtagt
caccatgcccgcttccagcattgacaccattctaatgttgacaccttgatgttccaccag
GCAAGTCAGAAGAAGCTGATGATCAAGCAGGGCCTTCTGGACAAGCATGGGAAGCCCACA
GACAGCACACCTGCCACCTGGAAGCAGGAGTATGTTGACTACAG
gtgagggcaggatgtttcagagccggggtgggtagagacggcacacttgctgccttgatg
caggagtatgtcaacaacaggtgaggatgggaaggtagagcccacttgccatctggacgc
aggagtacatggacaacaggtgaggaacaggtgagcatggaggttgtagagcccagggga
EXON 13  79 bp
tttctagtctggctcgtgggactctagagggagtcagtctgcaacagtaagtggtgagtt
cttctgtccagcgtcagtattttgatggtggctttagacttgccagataacactacataa
catcagtactgccctggaaagccattcagtgaatttgacctattgctacctctttttcag
TGAGTCTGCCAAAAAAGAGGTGGTTGCTGAAGTGGTAAAAGCCCCGCAGGTAGTTGCCGA
AGCAGCAAAAACTGCGAAG
gtgagtggcatgctgtcctcagtttggaatgtgcttagggagataatcctaagaggcact
ggcattcgtcttactttgtgactgtccgcagtccagccatatacgctagcatcagaggtg
cagcgcatacacaggtaatgctgcctcataccctggggtgcttgtttgggctctgcaggc
EXON 14  138 bp
gggatgagactgtcttcaaatcctcagtaaactaaggccctgtccgggtttgtagtcaga
aaacgtcctgttagattcagttgggatctttcttggtgccttgctaccttttgactcact
gaacctttcttgtccattattgcccaagatctaacacttaaccaattgctttcatctcag
CGGAAGCGAGAGAGTGAGAGTGAAAGTGACGAGACTCCTCCAGCAGCTCCTCAGTTGATC
AAGAAGGAAAAGAAGAAGAGTAAGAAGGACAAGAAGGCCAAAGCTGGTCTGGAGAGCGGG
GCCGAGCCTGGAGATGGG
gtgtgtggaaacacgttcaggttccttgggctggcttagtccctgcgtggggaaagaatt
acccaggtggtaccagctttgttactcttcttggaggagctgtggcctgggggtgggatg
ccaccgagtgcctttagtgcttccccatgttcctggagtgcttttgccctccctgtggaa
EXON 15  887 bp
ctagggtgtcactgaaaggtttacagaactttgtgtcacatgcagcatttaacccaaaat
atccttacaggtcctgaaaaaggcttgcttgactgtggacctttaccagatttccttctg
ggagagtcatagctttgttagtggatggtatctgtgagctttcattctctttctttctag
GACAGTGATACCACCAAGAAGAAGAAGAAGAAGAAGAAAGCAAAAGAGGTAGAATTGGTT
TCTGAGTAGTGAAGGCCACTTGAAGCTGGAGGAGAAACTAAAGCCTTATTGAGAAAACAT
GTTATAGATCCTTTTGTTGCTGAGAGAGTGGAACATAGGTCCTAGACAGGGTGAAGAGTT
CTGGCACATTTTAGCTGCTACTTTGAGACCTCGGTGATGTTACCTGGTGTGGTCATCCCA
TCTTGTCCTGTTTTAAGGATATGGGTGGTGAAAGATGAAAGAGGCAGAGTTTATCCCAAT
GACTTCTCTGTTTGAGTTGGGAAGCCTCACCTTCAGACCCAGTAACTGTCCGCAGCTGTC
TGCTAGTGGTTGTCTTAACATCGTAGTCCTAGTTTGCATTTTTTAAATCCCCTCTGTTTA
AAAGGTTTGTAAAACAAAAACAAAAAACTAAGTCTGCTCAGTGAAATGCTGTAGAACCCT
AAATAAGTGGTAGAAGAGTGTCACTGAATTTTGTCTCTGAATTCAGTATAACTGAGTTTT
GTCCATGCTGGTGTCTGGGTTATAGGCCTGATGGGCCTGGTAGTTTTCCATCTTGTTCTG
GCCTAGAGGTCAGTCCTTTGCACTTCCTCAAAGCTTGTGTACAGTGCTCACCTAAATCCA
TCTGACTACTTGTTCCTGTGCCCTCTTGTTTTAGGCCTCGTTTACTTTTAAAAAATGAAA
TTGTTCATTGCTGGGAGAAGAATGTTGTAATTTTTACTTATTAAAGTCAACTTGTTAAGT
TTTTTATGTATTCCTGTTGGGTTTTCTTGTTGATCTCATGCTAGCAGAGCAAAAATTGTA
AAATATTTTGATTAAAAATCTAGGGACCTTTATGTCCTATTTGAAAT
gtgatgcttttatgtttgttttctggtttttacatttttgttctgtatcttacacaatcc
accttgggccctgtcatctgatgtgagatcaagtactcagaggcagtgattaccacaaaa
ccactgatctctagaagaacagagaaggagagggttaatgtatttatacatagtgggcct