Gene CXCR3 Variant 1
DNA : 2.60 KbNT_011669
mRNA : 1623 bp NM_001504
CDS : 1107 bp NP_001495
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  80 bp
gtcatcctctgcccagcttttctggtcccaagcttgtagccagctcctccagagaggttt
cacccagtcacggaaactctgtggcctgaggtttagggaggtctggtagaggtaactccc
tggaagaggctgctgctgagaactgcctgaaactcccacttcctctgtgactgcaggttt
CCAACCACAAGCACCAAAGCAGAGGGGCAGGCAGCACACCACCCAGCAGCCAGAGCACCA
GCCCAGCCATGGTCCTTGAG
gtaagtgctgctgcccagccaggccaggccagaattcgaagtggaaaacccggggcatca
ggggaatgccagggctggcccacagcccagggtcaccacagggttgggtgagtagctgga
ggccgcatgggttgtggcagaaacagcactggggaattgggaacccagcttggccactga
EXON 2  1543 bp
cactatcccagagcccaggctgagcggatggagttgaggaagtacggccctggaagactg
gcggggacagttataggaggagctgctcagagtaaatcacagactaaatcagactcaatc
acaaaagagttcctgccaggcctttacacagccccttcctccccgttcccgccctcacag
GTGAGTGACCACCAAGTGCTAAATGACGCCGAGGTTGCCGCCCTCCTGGAGAACTTCAGC
TCTTCCTATGACTATGGAGAAAACGAGAGTGACTCGTGCTGTACCTCCCCGCCCTGCCCA
CAGGACTTCAGCCTGAACTTCGACCGGGCCTTCCTGCCAGCCCTCTACAGCCTCCTCTTT
CTGCTGGGGCTGCTGGGCAACGGCGCGGTGGCAGCCGTGCTGCTGAGCCGGCGGACAGCC
CTGAGCAGCACCGACACCTTCCTGCTCCACCTAGCTGTAGCAGACACGCTGCTGGTGCTG
ACACTGCCGCTCTGGGCAGTGGACGCTGCCGTCCAGTGGGTCTTTGGCTCTGGCCTCTGC
AAAGTGGCAGGTGCCCTCTTCAACATCAACTTCTACGCAGGAGCCCTCCTGCTGGCCTGC
ATCAGCTTTGACCGCTACCTGAACATAGTTCATGCCACCCAGCTCTACCGCCGGGGGCCC
CCGGCCCGCGTGACCCTCACCTGCCTGGCTGTCTGGGGGCTCTGCCTGCTTTTCGCCCTC
CCAGACTTCATCTTCCTGTCGGCCCACCACGACGAGCGCCTCAACGCCACCCACTGCCAA
TACAACTTCCCACAGGTGGGCCGCACGGCTCTGCGGGTGCTGCAGCTGGTGGCTGGCTTT
CTGCTGCCCCTGCTGGTCATGGCCTACTGCTATGCCCACATCCTGGCCGTGCTGCTGGTT
TCCAGGGGCCAGCGGCGCCTGCGGGCCATGCGGCTGGTGGTGGTGGTCGTGGTGGCCTTT
GCCCTCTGCTGGACCCCCTATCACCTGGTGGTGCTGGTGGACATCCTCATGGACCTGGGC
GCTTTGGCCCGCAACTGTGGCCGAGAAAGCAGGGTAGACGTGGCCAAGTCGGTCACCTCA
GGCCTGGGCTACATGCACTGCTGCCTCAACCCGCTGCTCTATGCCTTTGTAGGGGTCAAG
TTCCGGGAGCGGATGTGGATGCTGCTCTTGCGCCTGGGCTGCCCCAACCAGAGAGGGCTC
CAGAGGCAGCCATCGTCTTCCCGCCGGGATTCATCCTGGTCTGAGACCTCAGAGGCCTCC
TACTCGGGCTTGTGAGGCCGGAATCCGGGCTCCCCTTTCGCCCACAGTCTGACTTCCCCG
CATTCCAGGCTCCTCCCTCCCTCTGCCGGCTCTGGCTCTCCCCAATATCCTCGCTCCCGG
GACTCACTGGCAGCCCCAGCACCACCAGGTCTCCCGGGAAGCCACCCTCCCAGCTCTGAG
GACTGCACCATTGCTGCTCCTTAGCTGCCAAGCCCCATCCTGCCGCCCGAGGTGGCTGCC
TGGAGCCCCACTGCCCTTCTCATTTGGAAACTAAAACTTCATCTTCCCCAAGTGCGGGGA
GTACAAGGCATGGCGTAGAGGGTGCTGCCCCATGAAGCCACAGCCCAGGCCTCCAGCTCA
GCAGTGACTGTGGCCATGGTCCCCAAGACCTCTATATTTGCTCTTTTATTTTTATGTCTA
AAATCCTGCTTAAAACTTTTCAATAAACAAGATCGTCAGGACC
agggcatgttcgtgcatcattacagtcagcccagcccacctgggctccaggggcacttcc
tggttctccctgcctggccctgggtctgtgccagcccatcctgccttcatcaatgtctgt
ctgcagctttgtctctgccctcgtgggcactcctgttctactcacagggaaacacccaag