Gene COX7B Variant 1
DNA : 5.92 KbNT_079574
mRNA : 456 bp NM_001866
CDS : 243 bp NP_001857
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  130 bp
aaggagttctttcattcttcattagataccacccaccatacgtcattttataaagccgga
aactacatttcccaaaaggcctttatttttcctcgcgggaaaagggattgcaattactat
aggttttacaggtatcgcgagatttcgtcaaatctcattacggatcccggctgaaagcca
TTTTGTTTTTCAGCTCACTTCAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTG
TATTGCCGCAGTTCTAGCTTCACCTTCACGATGTTTCCCTTGGTCAAAAGCGCACTAAAT
CGTCTCCAAG
gtgagcaaaaattatgacaaatcatttacaacaaccttatatcaatgtgtcctcgcggcc
tctcgtgtgctttccttttacgaacatctcggccttctaatcttgaatgctgtctgtctc
ccatctcgtcccaagtcattgggatgatgtccttagcattggctttatcacccagtattt
EXON 2  125 bp
tgttgcatttcaaagtacactgctttaatagctacaatatgttttaacattttattgaac
tacataatactgtaaaattaacttccttggctttcctgattggcagtatcaatcacatat
gttttctttacctgacaattgataatatgcttctgtattcttttttcgttttcctgtaag
TTCGAAGCATTCAGCAAACAATGGCAAGGCAGAGCCACCAGAAACGTACACCTGATTTTC
ATGACAAATACGGTAATGCTGTATTAGCTAGTGGAGCCACTTTCTGTATTGTTACATGGA
CATAT
gtaagtactattgattaataatttctgtttcagatgtttttcattctcagtctatgcatt
caaagtgtcttaacatagtagtgtacatatctagttaggagggacttgagagattgtgta
atctaattacccacacagtgcaggggattttttccccccagcattcatccatcttctgtt
EXON 3  201 bp
actgctctagaaaattaggacagcaatcaggtttggcctatatggagggtattagatccc
aggtgagtttctgtgtatttttaacctatagaacagaatatctgtcattttcaagaaata
gtctccgagagagtgtactctggtttaaacacgtaactgacagcattttaattcttacag
GTAGCAACACAAGTCGGAATAGAATGGAACCTGTCCCCTGTTGGCAGAGTTACCCCAAAG
GAATGGAGGAATCAGTAATCATCCCAGCTGGTGTAATAATGAATTGTTTAAAAAACAGCT
CATAATTGATGCCAAATTAAAGCACTGTGTACCCATTAAGATATGGCATTATTGAAGAAA
TAAAGTACATTTGAAACCTTC
attgtaggttttgtttctttgtaaatgaaactaagcttgatcactttagcctttatgtta
atattaaagtcaaatgctgtgcagcttcttaaataggttttttttttttttttttttttt
ttttgggacgaagtctcactttgtcccccaggctggagtgcagtggcaccatctcagctc