Gene CASK Variant 1
DNA : 402.92 KbNT_079573
mRNA : 3123 bp NM_003688
CDS : 2766 bp NP_003679
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  86 bp
ggccccgccgcccgcgccggggcggtcgcctgcagaggaaggcgccgcagtctctgggcc
tcgcggccccactcgagcgtcctcggcaccgagggctcgcgggtcctgaggggaggaggc
gatcccggggctgggcactgagctcttgggcgcccccacccccgttttcgaagccctcca
CGCTGCGGCCGCTATCCCCTCCGGACCATGGCCGACGACGACGTGCTGTTCGAGGATGTG
TACGAGCTGTGCGAGGTGATCGGAAA
gtgagtctccacgcgagggagcgggagtgtggaaaaatgcatttcagtgatgccccggtc
ttcccgcacccgctcggggcctgccccctgccctccctccttcccctcttcccctctcgt
ccttctcatcctggagtatttatagacgtgtacctggagctcctgccaggcgggggcctg
EXON 2  113 bp
agaaaaatatgttggaagttatattacttaaattttattttgaaaactgtgttcaatttg
gagtctaaagtagaatggcaaacattatctatattatatagataatgaaacagtaagaca
ttaatgggaaataggaacttaagagaatcaatgaattaaaattgactttttgttttatag
GGGTCCCTTCAGTGTTGTACGACGATGTATCAACAGAGAAACTGGGCAACAATTTGCTGT
AAAAATTGTTGATGTAGCCAAGTTCACATCAAGTCCAGGGTTAAGTACAGAAG
gtaagagatggatttcaagtaagttatttgatgtctggctttattccatctccaaaatcc
atttaccaacctaaccttcatctgggggtggggaagcagagggtatgatgtagagggaag
tgggtggagacagtttaaactctattctagtttgtcagaattctaggacatagtatttga
EXON 3  106 bp
tgaaaagctatagtcaaagattttaaagggtaaaaagttaagctaagtttaaatggggga
tttcatctctctagttagagaagtatccatgttaccatagatcacatccattcattcatc
attcactctaattgtcttttgttcctacctaatgaagtatgctgtatgtttgttttacag
ATCTAAAGCGGGAAGCCAGTATCTGTCATATGCTGAAACATCCACACATTGTAGAGTTAT
TGGAGACATATAGCTCAGATGGAATGCTTTACATGGTTTTCGAATT
gtgagtgtgtattttaattcttaaagggtaaaacttgaagcaatgttggtgttggataat
gctaacacttttctcttgaaatttagcagtagttgtgaacttatctgttcagaaagacct
aaagtcacaagaaaaaaggattatgtcatcataaggtttacagtggcaaaggaagcaaaa
EXON 4  78 bp
tgaagatgactgtcatgccctttataatttatgtctatatttcattgaaagaaaggagat
ttaaataacataacccttagcagtaaatcaactaataacttagttacaatgtattcactt
tcagtgttgtcttcctggaatttcctcttttcttatgttctttttcacatttttttacag
TATGGATGGAGCAGATCTGTGTTTTGAAATCGTAAAGCGAGCTGACGCTGGTTTTGTGTA
CAGTGAAGCTGTAGCCAG
gtatgtattgtatatctaatcaccagaggtcaagttgaaaataaaaaaagaaaatgacaa
agacatcacatgacaaactgataaagagcatgctgctgctctttgctacagggaacatct
ctgttttagtatgtgttagtagaaccgatagtcactggaaatgcaaaataccgaacaatg
EXON 5  73 bp
cttttgagtctgccaacattttcattattaagcctcactttacaccaatcctgtctgctc
aaatcaaatgtgtccatggacagctaatatgagagtgggagttataaactaggagcactg
tatattaagttttaaaataaaaattgtttacagtttttagatttcttttgttttttacag
CCATTATATGAGACAGATACTGGAAGCTCTACGCTACTGCCATGATAATAACATAATTCA
CAGGGATGTGAAG
gtaagtcatttgttatcactaactttaatgtttgtgaagaaatactgatataacaatgat
aatcaagaattcttctttaatattgtcataaagaacatcttaattttacttctaagtaaa
aatgtatttaactgctttgtatttgggaagtcattgtactaattcttactaggaacacta
EXON 6  103 bp
aatcagccagacgtgagaatatgacaaataattcaagcatccagaataatttagaagttt
ttaatgtgtttctctattatcatgttatctaattttatgtaaactgcattgttcatcttc
aatgaatccttatcttcgggtttgttttttgtttgtttgttcgtctgtttttcttttcag
CCCCACTGTGTTCTCCTTGCCTCAAAAGAAAACTCGGCACCTGTTAAACTTGGAGGCTTT
GGGGTAGCTATTCAATTAGGGGAGTCTGGACTTGTAGCTGGAG
gtaagactgctttaaaaaaaaaaaattcttcaaaacctggtcacttgcgactggtataaa
actttcaagctacatattagcccaacctcagtgtttcatacctcattccaccccacccca
actcccaaaaagcatcatcagatagtttttaatttaataactctgtagtcataactagaa
EXON 7  176 bp
attagataagtaatttttttcacctatgtgaacttgattttatggagaggtggaggagtg
gtgagagtatatgtattggtaaactttttatttggattgttattgttctattatttttag
ttttcaagtgaaaatcccattttatgtaaacatttttccttaatgttgttttaaatgtag
GACGTGTTGGAACACCTCATTTTATGGCACCAGAAGTGGTCAAAAGAGAGCCTTACGGAA
AGCCTGTAGACGTCTGGGGGTGCGGTGTGATCCTTTTTATCCTGCTCAGTGGTTGTTTGC
CTTTTTACGGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGAAAATATAAG
gtaatgcatcatgaacattttctttttccattgagattaatttatcctgaaaaatgtttt
tttgaagttactgtctgtctttgcccactaattgactgccaggtagttaccccatcagag
aaaaggtctttgcttacatcattgatccagtggccttggtaggcaacataggcctcaagt
EXON 8  123 bp
taaagaacaacagaagaattgcatttgtccttttcttagaatgcaagcctttagaatcaa
atttctgttctttgctctcagaattttattcacattgaagcaatataggaatattaaata
atagtgaatgttaatgtctcatttaaggtaactatgtagttttcctttcctcctcctcag
ATGAATCCAAGGCAGTGGAGCCATATCTCTGAAAGTGCCAAAGACCTAGTACGTCGCATG
CTGATGCTGGATCCAGCTGAAAGGATCACTGTTTATGAAGCACTGAATCACCCATGGCTT
AAG
gtacatgagcattcacaggtcaccttctacactttgtctgaacacttccagtgacaggaa
tgcgttgctctatgagatggtcctttttaccttttcttttttctgagcagttttcattag
tttttttcatcttgtttgctgttcctgcacatcatctgtgaacatctgaatagaagacat
EXON 9  84 bp
cagtttaaccttaatatccctcatttcagattgcttaccagtatcatggaataaaatctc
caatctaaaattcaatctgagttttatatttaagaattttagctttattatttgttttag
attaagcttctgcacttttttaaacggttatatatgttcattatctttcatcttacatag
GAGCGGGATCGTTACGCCTACAAGATTCATCTTCCAGAAACAGTAGAGCAGCTGAGGAAA
TTCAATGCAAGGAGGAAACTAAAG
gtaaattaaacaaatcagcaaaaaagccaaacagatatagttaatgatcatgtttttatt
ctattttggtgcccataaatatgtactaatgctggccattgtttttgttgtagctaaatt
ctcatttccaaaaattaccaccacttcaataagattttggctttttaaattatttaaggt
EXON 10  100 bp
atatgcatatgtaatttatttcaaggaatctgaaataatttaaaaactacctctcttcta
gccatcatctcctatatatttgacttaatggataatccttaagataaataatttgttaaa
taacttatttatatttgtgtatttgttttaataatctattttttcatctctttgttttag
GGTGCAGTACTAGCCGCTGTGTCAAGTCACAAATTCAACTCATTCTATGGGGATCCCCCT
GAAGAGTTACCAGATTTCTCCGAAGACCCTACCTCCTCAG
gtaattggataattcacttattcacctgtgtgggtcatttggcatttacatccattctct
cccattgtgaataaacttttcctgtgcatttagttaaatcctccaacggattctaaggaa
gtttgtcagcaaccaaatcctgtctacatgtgtcttgttccttttcattttaataccaaa
EXON 11  18 bp
atgtctgaaatcccaaacagttccagtgattgtactcatggaacatgagggctcactttg
gggtcagctgggggaccatgcttctggtggctcatgtagtgggccgaactgtggcttgat
aacctgcttgttctaaaatcatactgtttgttgtttgtccatatgctgccttcctcctag
GACTTCTAGCAGCAGAAA
gtaggtatccctttgttttcctttaaggtgtatcttttatgcaaaagtgtttggctttgc
atggttcgtaatcagcttgactttttccttggctgtttgtgtgtagttgtttaagtatta
attttaacactgcctggtcataaaattaaaacttggatatattgatttttgaggcattgt
EXON 12  122 bp
ctgaaaatactgtgtccttaaattatatgaaactcatttaagtctatccttcagtaaaga
cactagcctttgaagttctgatatgaattcattgttcttaagtgtaagatttaggtttaa
aaagttagtttgacattgactttctatactggctgtttcttttctgtttgtcccccttag
GAGCAGTCTCACAGGTGCTGGACAGCCTGGAAGAGATTCATGCGCTTACAGACTGCAGTG
AAAAGGACCTAGATTTTCTACACAGTGTTTTCCAGGATCAGCATCTTCACACACTACTAG
AT
gtaagtctgtctttttattattcttcttttttggtgaattgaatattggccgggcacggt
ggctcatgcctgtagtccaagcactttgggaggcagaggcgggcgtatcaggaggtcagg
agactgagaccatcctggccaacatggtgaaacgtggtctctactaaaaatacaaaaatt
EXON 13  78 bp
gactcatattctgacaagtttcacagaacaattcagaggttattaccaagaggatcccac
tgaaatcatcagcctgcctttttaaaagaaaaatattgtttagtgaaataataaatatga
agctctgatttttagcaaagaattgtgagtgtttactggattttcttctttgctttttag
CTGTATGACAAAATTAACACAAAGTCTTCACCACAAATCAGGAATCCTCCAAGCGATGCA
GTACAGAGAGCCAAAGAG
gtaagtgatatattttatagaagtatttggcatcatcatatttgccacctttattgaaga
catttctgttgcacattaagaggcagtttccctggagtcacaatttgactcattatattc
agatttagtatttctaagtttattactgaacatacagaaaagaaaaaagatctctgcagc
EXON 14  81 bp
ttattaccatcaatactgttcttctatgtattaataacatttgaataaaatgaaaagttt
ttcaaaataattgttttgcctgccataaaaatccactcataatttttaacttaaaagaat
ttaacattttgtaaatcttgtgtcatgtttgtattattgtatatcttgtttattttttag
GTATTGGAAGAAATTTCATGTTACCCTGAGAATAACGACGCAAAGGAACTAAAGCGTATT
TTAACACAACCTCATTTCATG
gtaagtaataattaaacttccatagaactgaaacctcactttcaaaagaagtttttaaac
taccctcataaaatgtagccagcttcatctcatgcatttttatccatatcatatgagact
attaagattacaataccaggtaataccaaatattttaagactgttttgtttactttgtgt
EXON 15  189 bp
gctgcaaaggaaggatcgcttgagcccaggagatgaagcctgcagtgagctgagatctca
ccactgcactgcaccctgggtgacagagtgagaccctgtctcaaaataaataaataaata
aaataaatttctgctgaaatagtaatgttattaataatttttttcttcataaaacactag
GCCTTACTTCAGACTCACGACGTAGTGGCACATGAAGTTTACAGTGATGAAGCATTGAGG
GTCACACCTCCTCCCACCTCTCCCTATTTAAACGGCGATTCTCCAGAAAGTGCTAACGGA
GACATGGATATGGAGAATGTGACCAGAGTTCGGCTGGTACAGTTTCAAAAGAACACAGAT
GAACCAATG
gtaagtaggaagagaaagttttcaatactctcataagatcccagcatgagttatatcaac
taacttcaacctatgctactaggagttggggagggaaggaagacatggatagttttaaag
aaatcagtttccagatcttcagttcccccctgcccttcttttctagaattgttctgcctg
EXON 16  79 bp
tttttgtcatggagcaattttgtgtgcgtggcatactggatggtcttctccattttccat
attttctttaattttttttaactggtaattaaaattatctaccgcaaaatcacaaatatt
aagagaagcactgtcatagtaattctacttttgctgaactttttattttttttttaacag
GGAATCACTTTAAAAATGAATGAACTAAATCATTGTATTGTTGCAAGAATTATGCATGGG
GGCATGATTCACAGGCAAG
gtaagtttcatatatatttctttctttgccttccttaattttttttccctgtagcctagt
gaagaaaatgtttttgtttgttttgtttttgagatggggtctctcactatgttgcccaga
ctggtcttgagctcctaagtgcaagcaatcctcccgtctcagctttccacaggtgcatgc
EXON 17  86 bp
tgttttgatgaggttactacatgagttaaataattctgctgcaaccaaacttgtacctgc
ctctgaaatattggccctcaatattcaacttagtttttaaaaattacattgatgcctctg
gattttgttactatgaaagcatatatcatttcatgtttataatgttatataatttcttag
GTACACTTCATGTTGGTGATGAAATTCGAGAAATCAATGGCATCAGTGTGGCTAACCAAA
CAGTGGAACAACTGCAAAAAATGCTT
gtaagtaaatgaaagtttttcctttcctaaaattgacttttactttgttagcttgttttt
aaatatacaaataaggagtattcttctgtaatcagagaatttctggtaccatatttatgt
ggacttgaacttatataacattcataaaactgacaactagaaaaatgttgaaatacaata
EXON 18  69 bp
acttactctactgttaactcgagcagtccctgcttcatgactacatttcattttccggct
atgtgctctcagatggcttgtgctaattgcccccatgtgttttgagtggcttcttacatg
gttttgtgaacaattgtttgtaagaaaacttttctttctttcccaccaccccccctccag
AGGGAAATGCGGGGGAGTATTACCTTCAAGATTGTGCCAAGTTACCGCACTCAGTCTTCG
TCCTGTGAG
gtaatgactctaacaaaccacccccatctgctctgagttcttaactaactgtctgctgat
ggctgtatgtttttgctttctgggaaattgtttctgcctgtgctgttagatcactgcaca
ccaattttacaacaaagataacggaacagagtaggtcccatccacctactcagccctgct
EXON 19  69 bp
ttcgaactgcaaaatttttttcatacttctgtgaaatcatgcaagcaagtcagtatggca
cctatacagctcaaacctcaaaggaaatggttgtcagactgtggttgttactgttgatgt
aaatatctctgtgtttctgtgctggtgttctgtgttaatgaaccttgtgtcttatttcag
AGAGATTCCCCTTCCACTTCCAGACAGTCCCCAGCTAATGGTCATAGCAGCACTAACAAT
TCTGTTTCG
gtaagaactttagctccacacagcaaagtgtgacaattttgttggtgctcacctgccatg
agtgttctagttacatgtgttcagtggaaatagtgtcttctgctgatatacaaggctact
acagctacaatgcactttactcctggaaaatctttttcaacatttccttctcattaaaaa
EXON 20  36 bp
tggcctgggtttgactttttgataactcaacatttctgataaatggaataatgtatatta
tctctttacaacttaaatctagctcatttttttaaccatattgtaacagaacacacaaat
tactttgtactcttgaaaaataaatgaaaatttttctcctgggttggctttattctacag
GACTTGCCATCAACTACCCAACCAAAAGGACGACAG
gtgaatagatatcctctatagaaacttctctaaactgagcagctaatagccaatccttta
ttaaccctttccatcccataatgtttgcattttggaccataacatttgagcattgagagc
ttgtaccatttcattttaacacattacacatgactaattctctataaagaatttttcctc
EXON 21  197 bp
ttactagtacattgtttctagcggtagaagttttttgtgtcgtatttccatgcatcgttt
ttgctttcaccatctgatgtcctgtttgtattgtaactgttggtgtgtggttatgacatt
agagctaacttctctttcacatcactatggcatcctttcttacgaactcctgttttatag
ATCTATGTAAGAGCACAATTTGAATATGATCCAGCCAAGGATGACCTCATCCCCTGTAAA
GAAGCTGGCATTCGATTCAGAGTTGGTGACATCATCCAGATTATTAGTAAGGATGATCAT
AATTGGTGGCAGGGTAAACTGGAAAACTCCAAAAATGGAACTGCAGGTCTCATTCCTTCT
CCTGAACTTCAGGAATG
gtatgtttttatgcgtgttttgctttgcttggttataaaaacaaagccctgaccatccat
tttccaattttatattattttagagtgtaaaacctgtttgatatattccttcctttacga
gccaaacaaaatttaaattagtcatccaagaattctatatcttcagtatctagtgagatc
EXON 22  116 bp
aaaacatttctaggaaattgtcatgaaaaccaaagaatagcctttgtccaaattttttaa
aagattaggatgagtatggttatgctgttttatataaattcttcaaatggatgactcttc
tattttatcaaccagaattataaattcattttattttatttttctttttgtatgtgctag
GCGAGTAGCTTGCATTGCCATGGAGAAGACCAAACAGGAGCAGCAGGCCAGCTGTACTTG
GTTTGGCAAGAAAAAGAAGCAGTACAAAGATAAATATTTGGCAAAGCACAATGCAG
gtagggaaaagcacaactgttactgaggctgggttaagcatctccaagacctaaaaagat
gtaatattttaattcagtcttcagtgttctctatccaaaaaattctaccatatgagatct
tcatcaactttcaaaacctttaagaaacccctacctccaattaatatgttgattatttgc
EXON 23  66 bp
atgctatatgacttaaattacatgtaagccatatatcataagttggattcatatttttaa
gacatggttttaatataactgtagttttgccagtaaaattataatttatgtacatgaaat
agtcattctacaaatttacctttcttctaaatctttgcgttttagtgtttgatcaattag
ATCTTGTCACATATGAAGAAGTAGTAAAACTGCCAGCATTCAAGAGGAAAACACTAGTCT
TATTAG
gtaagtttgattgtgtaagtgagttgcttattctcactttcaaaacattttgtgaacatt
attaagagttgtcagttttaacattctttttttctaaatgacataggcgcacatggtgtt
gggagaagacacataaaaaacactctcatcacaaagcacccagaccggtttgcgtaccct
EXON 24  81 bp
tcaattagatcttgtcacatatgaagaagtagtaaaactgccagcattcaagaggaaaac
actagtcttattaggtaagtttgattgtgtaagtgagttgcttattctcactttcaaaac
attttgtgaacattattaagagttgtcagttttaacattctttttttctaaatgacatag
GCGCACATGGTGTTGGGAGAAGACACATAAAAAACACTCTCATCACAAAGCACCCAGACC
GGTTTGCGTACCCTATTCCAC
gtaagcaatgtctcaatctcttttcattatatttttcctatcacttttttaactctataa
tttatgtatttttttctgattacataaggtataactgttcattgtaggaaatttgtaaaa
tcaaaaaaagaacaaggaggaaaatgagttaacagtaatcccaacccctctttccctata
EXON 25  203 bp
taaatatggtttctagaatttagttctgcaaagccactgggggtgagaacaggggatatg
agatatacgctaaagaatccacagcttttaggaagagactgggtttgagtaaatctgttg
ggagtgtagtaagctcatcagctcagccttttaaacctcttgtgccatgcgactttgcag
ATACAACCAGACCTCCAAAGAAAGACGAAGAAAATGGAAAGAATTATTACTTTGTATCTC
ATGACCAAATGATGCAAGACATCTCTAATAACGAGTACTTGGAGTACGGCAGCCACGAGG
ATGCGATGTATGGGACAAAACTGGAGACCATCCGGAAGATCCACGAGCAGGGGCTGATTG
CAATACTGGACGTGGAGCCTCAG
gtaatgcccagcctccccgaatgtctgacatcctgcctgcatgccaataagcacagattc
tgaaatcaaaaatgccatcagaaagtcacaggtcacataataatttcataaaccacagaa
aagtatcagtaatggaggcgttgggggttcacagtctagaatgccagctgactaatcgtt
EXON 26  84 bp
tttagaaaaaaagtaatataagttatgtataaagttggtaaatttaataataccttgcca
aaaatttgagccaagagcttggaattttcagttgtataaaaatttttatagactcatttg
aaagttacattagttatttcttcttttaagtcgggattttttttttttttcttaacacag
GCACTGAAGGTCCTGAGAACTGCAGAGTTTGCTCCTTTTGTTGTTTTCATTGCTGCACCA
ACTATTACTCCAGGTTTAAATGAG
gtaagaatcaatctgtttttccccaaataagctgtaaggatcaagccttactccccagca
cagtcagaagcgtgtcagtctacatttgcagcaaggctgctctgatgaaatgggatgtgg
aatagaatgctacatgggacagtcttatcagtaagctgacttctaaaatctgaggacaaa
EXON 27  507 bp
ctgtcatggagcggacttggcctcatgctggcatatggcatatcagggtctggccttgac
tgtttctgacactgggatgaacaaaaatgtgaaaagagaacgaatccaactgatttctct
cttctgtttgcttttccctcctctcatgcccacccctacctccatctcatcaccatttag
GATGAATCTCTTCAGCGTCTGCAGAAGGAGTCTGACATCTTACAGAGAACATATGCACAC
TACTTCGATCTCACAATTATCAACAATGAAATTGATGAGACAATCAGACATCTGGAGGAA
GCTGTTGAGCTCGTGTGCACAGCCCCACAGTGGGTCCCTGTCTCCTGGGTCTATTAGGCC
TCTCCCCAGATATCTGAGCATAACTGGGAGCACCTCATTTGTGGAAAAGCCTCTTTGTTA
TCGGCCTTGTGTCAGCAGGTCATGGTCCCTAGAGACTACCTAGTTGTAGTGTGACCTACA
TTTATAATTATTGTCATGTCCGAATAGATAGGAGGAGAAAAACAATTACACACTAATTTA
AAGAGACAGTATCTTTTTTAATCAGTTCTCCTAAACTTTAATAAAATGTATCTTTAAATG
TATGTATTATTCAATCCTTTGGAATGTTATATTTTTGGAAATCATAGCTTTTTATTTCCA
AGGCCCCTAAAAACTGCACAAAATAGA
tgctgctttctataatctattttaataataataaacaatgattctgttaccttgactggg
ggtggaacactacattctttttagagtctgattttatggattggaatattgggatatctt
tctttcctttatttatttgaaataattagtgtagtgattacaaaacagtcataaattttt