Gene BTK Variant 1
DNA : 36.74 KbNT_011651
mRNA : 2574 bp NM_000061
CDS : 1980 bp NP_000052
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  133 bp
atagactcaagatagtagtgtcagaggtcccaagcaaatgaagggcggggacagttgagg
gggtggaatagggacggcagcagggaaccagatagcatgctgctgagaagaaaaaaagac
attggtttaggtcaggaagcaaaaaaagggaactgagtggctgtgaaagggtggggtttg
CTCAGACTGTCCTTCCTCTCTGGACTGTAAGAATATGTCTCCAGGGCCAGTGTCTGCTGC
GATCGAGTCCCACCTTCCAAGTCCTGGCATCTCAATGCATCTGGGAAGCTACCTGCATTA
AGTCAGGACTGAG
gtgggtctggggtatggcaggggctgggcagcagcagcaatgtaccttgcttgggacccc
taaaaaccagagagacagcatggctggtgccatttatcagctagtggaggaggctgacgg
agggtgggagtgtcatcagcacaaggccctggcagtcccttctggtgattagagaggccg
EXON 2  171 bp
catccattatacctgaaacctgacagagctgggggctgtgggaggaggttggtaggaaga
aattattttgtgagctgtgcacatttttgttccatttgaaactaggtagctaggctgagg
gggaaccaagagggatgaggattaatgtcctgggtcctcaggaactttcattatcaacag
CACACAGGTGAACTCCAGAAAGAAGAAGCTATGGCCGCAGTGATTCTGGAGAGCATCTTT
CTGAAGCGATCCCAACAGAAAAAGAAAACATCACCTCTAAACTTCAAGAAGCGCCTGTTT
CTCTTGACCGTGCACAAACTCTCCTACTATGAGTATGACTTTGAACGTGGG
gtaagtttctcgactatgaaaactgagtttcaagatatcaaggacttggccttagatctt
tcttggggaagaggtaaattttcgttggtaggaggaggggagtagaatggacctaagttc
tttcaaattcagcaaaatatttcctagcctataactagctaaagccggaaagtcaaaggt
EXON 3  99 bp
atttgccctccatttggtagtcatagatttatagatctggaaggatttttttttcttccc
ccacatgacaggtcctggtgccacctcactttgttgaatgattagataacaaaatctaat
catctggttgcttaatccctcttaatctttctccattttcttcctcattctacttctcag
AGAAGAGGCAGTAAGAAGGGTTCAATAGATGTTGAGAAGATCACTTGTGTTGAAACAGTG
GTTCCTGAAAAAAATCCTCCTCCAGAAAGACAGATTCCG
gtaagaagagaccaatgtctgagatggggaacagcagatttgaagaaatttgcaacattt
aaattctctgtaaatagactggtgatgctgtgcaacgtggaacacggtcaagtttccttt
aaaaattcttcactctaccatattggttataaagaatcttagcttctttccttcatattc
EXON 4  69 bp
tatgtgttgggtcgtattggatatgtgtccctattggcctatagaaagtaatcactaaga
atcagccttgtctgtgcaggagaaacttctgaagccacagcaaaaggcttctagtaccta
aggaaattcagaaaagagcaatgcatcaaccaataaccattttttcttatttcattacag
AGAAGAGGTGAAGAGTCCAGTGAAATGGAGCAAATTTCAATCATTGAAAGGTTCCCTTAT
CCCTTCCAG
gtgagttattttctctcaccaaatctcgaaaggcccctgtaacacaattagaaggggtgg
tggggtgcagggcagagggaaggctacgaggacccagtgaatagaagttgaggtggacaa
ggatgctgaaccaagaaatgagactggcatgggctaagaatgtttgcttttctatttacc
EXON 5  82 bp
aagagttcaggaatccttcagatagttcacataacctgaacaccattgctgactgaagat
tctgcctttctttgttttctacaataaatatacaaattgtcccctaagattagtactttc
aaggtctttctccttttttctgaatcctaactgctgaagtctgtgttttcatcgacccag
GTTGTATATGATGAAGGGCCTCTCTACGTCTTCTCCCCAACTGAAGAACTAAGGAAGCGG
TGGATTCACCAGCTCAAAAACG
gtgagaattatttggaaaataaatgtttccaaagaaagaaggaaaggaaggaagaggaga
tagacgggaggaaaaggaaagaaggaagagagaaacgagaaagaaagagaaaggagaaac
gtagagagaaaagaagaaaaaaatggatagaaggggagaaaagaaagagagagggagggg
EXON 6  129 bp
cagggcacagtcaggcaggccagtcatgtgagccaactggtcctgtgatctgctctcctt
cagggtggccaaggagggggcagttgcttgaagttcaccactaagctcaaagaggaaaac
atgcaaatggtggcttctcctccatgtcagatgtgatctctctcttctttcctgctacag
TAATCCGGTACAACAGTGATCTGGTTCAGAAATATCACCCTTGCTTCTGGATCGATGGGC
AGTATCTCTGCTGCTCTCAGACAGCCAAAAATGCTATGGGCTGCCAAATTTTGGAGAACA
GGAATGGAA
gtaagcaatctgatcgatataatttctttctcctttgactgtttccatcactctcccaag
ggtctgtcaagcccagggtcatagcataaggttgtacactttgggtgctaaacaaagggt
cctgggggagggaggaggcacatgggggctgaaatccagctggtaatctgctctccaagc
EXON 7  68 bp
catgggggctgaaatccagctggtaatctgctctccaagctatgtgacctggcatgccta
gctactttttctaacttgcctaaaggcactcaatatggacggcaaagtccctgaccaaac
ctgtccttggcccctttcctaaagtgcattccatatcatcactggcttcttgttttgcag
GCTTAAAACCTGGGAGTTCTCACCGGAAGACAAAAAAGCCTCTTCCCCCAACGCCTGAGG
AGGACCAG
gtatacagggaaactgggtgctgccactgcttaaatggaaacttatagtcaagccctaag
aacacactagagtcttagaattaccctgggacttggcagtgttaattggtattcttgcta
agatgggggatttgttcttctaattaggatttcctcctcgatggaaagatagaaggctct
EXON 8  188 bp
tatatgtgtgcaaggctgagaactcctgcactggtgcttaaaaatggttgttgaatgact
gctgagtaatattttagtatgcctgatttgggtgtcttgagtaagccagagagttgggag
agaagagaagagtgcttggtatcttgacaaaccctcctaccttttctcctaactacatag
ATCTTGAAAAAGCCACTACCGCCTGAGCCAGCAGCAGCACCAGTCTCCACAAGTGAGCTG
AAAAAGGTTGTGGCCCTTTATGATTACATGCCAATGAATGCAAATGATCTACAGCTGCGG
AAGGGTGATGAATATTTTATCTTGGAGGAAAGCAACTTACCATGGTGGAGAGCACGAGAT
AAAAATGG
gtgagtccacaccagcccttcctgagcctggtgcctgcccactccctacacgcaaaaagt
gctgcggcataattcccgtgatcagcatcctcatcagagactgttcttcccacaccagac
tgaacatgctctccctccaagtacttcccagcgtgcagctccctatacatggcctctgcc
EXON 9  63 bp
ctgcacctcactggctcactgcctaaccatgcatcagagacatgattgtctttgagggag
gtgcatgatacatatacctccatttgagatttgttctgagctcagggacgtgggcatatg
aatctgtctcctggaggctggggaggtgctggatgaactgccacattgtttccttcacag
GCAGGAAGGCTACATTCCTAGTAACTATGTCACTGAAGCAGAAGACTCCATAGAAATGTA
TGA
gtaagtatgtttatgtcagtccacaatcttccaggaggaactctctctctctatatatat
atatatttatttatttatatatattttatatatatttatatatatatataacacacacaa
gtgtatatatgtatacatatgtatacatacactggtgtatatataggtatattatgtata
EXON 10  55 bp
tcttcaatgccaacctgggtttgggaaagggatacagtgtgctatgcacatgacagatgc
tcagtaaatagggtttgagtgagttgactgaatcactgacatggacaagccctggagggt
gctgtaacctccaatctgcttatgaccaggagccactcaagcagcactctcccttcacag
GTGGTATTCCAAACACATGACTCGGAGTCAGGCTGAGCAACTGCTAAAGCAAGAG
gtaagtgtggaaccactagcacacagcattctccttgcataagtgaggatcttgaactga
gggcctgttctgccccctacctttgggcaaggcagtgtcaaagctgccatcgtctgggat
cccaattacaccattttttttgtttttgtttttctgagacggactctcggtctgtcaccc
EXON 11  80 bp
catgagccaccatgcccggcctgcaccttttaatattaaaagcaatgaggctgtagctca
agcgtggaacttggcagtaaaatcaggggttgttctattttctctctcaagtttgggcag
gtgggatgcaggtgtgagcaccacttcctcctacagacagcttctttttcgttgtttcag
GGGAAAGAAGGAGGTTTCATTGTCAGAGACTCCAGCAAAGCTGGCAAATATACAGTGTCT
GTGTTTGCTAAATCCACAGG
gtgagtgctactattccaaggccctgaggacaaagaacaggggtaccctcctaatagctc
cttgatgctgtgcccgtcccacttcctctgtctctgaaactcaaaactcatctcacttca
cttcctgggttctgttgacctttgtgcccaagttactgactaagcatccacttcttcagg
EXON 12  128 bp
ggtgagtgctactattccaaggccctgaggacaaagaacaggggtaccctcctaatagct
ccttgatgctgtgcccgtcccacttcctctgtctctgaaactcaaaactcatctcacttc
acttcctgggttctgttgacctttgtgcccaagttactgactaagcatccacttcttcag
GGACCCTCAAGGGGTGATACGTCATTATGTTGTGTGTTCCACACCTCAGAGCCAGTATTA
CCTGGCTGAGAAGCACCTTTTCAGCACCATCCCTGAGCTCATTAACTACCATCAGCACAA
CTCTGCAG
gtgagtaccaggggcaactgagaagggagttacagacaccaggataagcaatgcaggaca
aggtgataagaggaagaatctgcctcacaggacagtgtgaattcactgtgaaaggaaatc
cctgtgatactgggtagaagctggtaaagaggtggtcagaggcagacctacacccaacag
EXON 13  75 bp
ccctgaaaagtattttgtgagaggagaaacctctggaaatatgtgggttcatggaggtct
tctgggattcaaaatgtactagaaagatacacaccggaagtgtgaggctttaagtgagga
tgtgtgaggcatcccacctcctacaccacaccaacagcatgacctctctctctgtttcag
GACTCATATCCAGGCTCAAATATCCAGTGTCTCAACAAAACAAGAATGCACCTTCCACTG
CAGGCCTGGGATACG
gtaactccttatttctctggggtagggtggactggccagttgcaaaaactacctttgctg
gccttgccttagggagtgtccttgaggtacactgttctgcagcagctgcctcaaggacgc
tcaagacagatccaagcaaaagttattcactgattttcttcctctagtggctacgactgg
EXON 14  172 bp
cccagattcctctaaccaatgaatcccgtttctgagattgacttaagcaaagacagatta
gtacttctaaaaatttcccttttactagttttcctatttctaccccagtagggatttttg
tctattgtaagaattatacattcatgaccccaaagaatcacaccaagactttattgttag
GATCATGGGAAATTGATCCAAAGGACCTGACCTTCTTGAAGGAGCTGGGGACTGGACAAT
TTGGGGTAGTGAAGTATGGGAAATGGAGAGGCCAGTACGACGTGGCCATCAAGATGATCA
AAGAAGGCTCCATGTCTGAAGATGAATTCATTGAAGAAGCCAAAGTCATGAT
gtgagttatagcccaaactcaactctcaatctatttgctggagtctaggaattcacacaa
caacccactgaggcttaaagatgacttacagtaagagaggtttgggacgagggactgaag
tttacctttaactggcggtagtcctaagtgctaagataatagtttctgtgccttagatat
EXON 15  217 bp
cctgcttgcttccacattttaagcacttttgagatttagggtgggaaagaggaaaataaa
cttgctggtgtgaccccttatctgatgctctactcctaggtcagccccttcctccccagc
ccctttattgctattatgcagagccaaaaggagaagactagttccttgcctttcctgtag
GAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAGCAGCGCCCCAT
CTTCATCATCACTGAGTACATGGCCAATGGCTGCCTCCTGAACTACCTGAGGGAGATGCG
CCACCGCTTCCAGACTCAGCAGCTGCTAGAGATGTGCAAGGATGTCTGTGAAGCCATGGA
ATACCTGGAGTCAAAGCAGTTCCTTCACCGAGACCTG
gtgggaccttagaaggattggcctaggacaaagggctgatggggtggaagtagcagtgga
agatatatcatacatggttgaggggggctgctggtgccatcatttcaattttatctagaa
agtactataagttaggcgtgcctctgccccagtgctgagcccatcaaatatctccagcct
EXON 16  65 bp
acgtggtggaaatgaatcaaaatttcttggtggcatcaacagattcctattaggtgggaa
ggtgtctgtagtcgaaggagatgaagcttccctggcttcattctactggtcagcagaagc
tttgtgcctttaacctctgtgctggggacggagtctcactggtctctgtttgcactacag
GCAGCTCGAAACTGTTTGGTAAACGATCAAGGAGTTGTTAAAGTATCTGATTTCGGCCTG
TCCAG
gtgagtgtggctttttcatctttccctccagaagtaaaaatagcacagtatgaaacatgg
gtaggtgttacagttttaatcctctccttttcttttttttctcattctagcgttttctgc
cgatctttctattctttttcttcctctgagttatttaagccacctctttcatccttttgt
EXON 17  119 bp
aatcagatacaaaaacaggaaattcgttaaaagtaacgtttgtagaagatactagttgag
gaggagagacttttgagaaagcctgtgtgtgtttgtgacactcttgtgaccgtgccaaga
aaacgtaagcaaatatcaagcctccaaatcctaatgcaacaagtcctgaatcccttgcag
GTATGTCCTGGATGATGAATACACAAGCTCAGTAGGCTCCAAATTTCCAGTCCGGTGGTC
CCCACCGGAAGTCCTGATGTATAGCAAGTTCAGCAGCAAATCTGACATTTGGGCTTTTG
gtaagtggataagattacacagattatacagctcaaaggataagaaatgcaatgggaaaa
ttcacactttgcaacctccacagagatattgttcttgctttcattcttccaatccttggg
gagtgcttactgtgtgtcagccaccacaggggtttctgaggatgaaaactaaactggaca
EXON 18  158 bp
tagtacgaccttgatctccatctagtgtggtcagtactatagcagaaatttgggcaaaat
ataaaaagcacagagcggggaaccaactgattctaatctttgaggttgatctaggaagac
taggacccctgctatccaaaaagactgcaaaccaatttaataatttttttcaccttctag
GGGTTTTGATGTGGGAAATTTACTCCCTGGGGAAGATGCCATATGAGAGATTTACTAACA
GTGAGACTGCTGAACACATTGCCCAAGGCCTACGTCTCTACAGGCCTCATCTGGCTTCAG
AGAAGGTATATACCATCATGTACAGTTGCTGGCATGAG
gtaagtgctttattaggatctcttaaattatttccttgaatctacttgcccatttagctg
gccattcagccaccaaagactgatagctgcacacattcttttttttcctttttttttttt
tttaatttgagacaaggtctcgctctttcacccaggttggagtacagtggcgcgatcttg
EXON 19  503 bp
gcacaaagactttatggagagctgctatttcttttttttttttttttccttttgtaatcg
acagggcatgctactgggcatagagcatatatttaataaacatttgctgcttactcattg
catttcccttgaattctggattctagccactctaacactttactttttctttggttttag
AAAGCAGATGAGCGTCCCACTTTCAAAATTCTTCTGAGCAATATTCTAGATGTCATGGAT
GAAGAATCCTGAGCTCGCCAATAAGCTTCTTGGTTCTACTTCTCTTCTCCACAAGCCCCA
ATTTCACTTTCTCAGAGGAAATCCCAAGCTTAGGAGCCCTGGAGCCTTTGTGCTCCCACT
CAATACAAAAAGGCCCCTCTCTACATCTGGGAATGCACCTCTTCTTTGATTCCCTGGGAT
AGTGGCTTCTGAGCAAAGGCCAAGAAATTATTGTGCCTGAAATTTCCCGAGAGAATTAAG
ACAGACTGAATTTGCGATGAAAATATTTTTTAGGAGGGAGGATGTAAATAGCCGCACAAA
GGGGTCCAACAGCTCTTTGAGTAGGCATTTGGTAGAGCTTGGGGGTGTGTGTGTGGGGGT
GGACCGAATTTGGCAAGAATGAAATGGTGTCATAAAGATGGGAGGGGAGGGTGTTTTGAT
AAAATAAAATTACTAGAAAGCTT
gaaagtctttggtatctctattaatcatgcagcctccctgaagcgccctatctcagtatt
ccagaaagctgctgtgtagcattagtttggcatattcctacactgagaactcgacaggat
cctccaggtttaagccctcttgttaactcctgcctctgaatcaaagatgcattaagcaaa