Gene ATRX Variant 3
DNA : 280.51 KbNT_079574
mRNA : 10455 bp NM_138271
CDS : 6867 bp NP_612115
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  235 bp
gggactaaattggaccccctgcgaaaaggtggaggggatcaaatgacgtcgaccgcctta
gcaacaggcccccaaagaaggtgaatttccgtagccaataagactctgtgctttggagga
ggtagccaatggctgacggaaagagaaagagggaggacgcgccaattctcctgcctgagc
CTCGGCCCAACAAAATGGCGGCGGCAGCGGTGTCGCTTTGTTTCCGCGGCTCCTGCGGCG
GTGGCAGTGGTAGCGGCCTTTGAGCTGTGGGGAGGTTCCAGCAGCAGCTACAGTGACGAC
TAAGACTCCAGTGCATTTCTATCGTAACCGGGCGCGGGGGAGCGCAGATCGGCGCCCAGC
AATCACAGAAGCCGACAAGGCGTTCAAGCGAAAACATGACCGCTGAGCCCATGAG
gtaaaacgcaaccccgtctcatgggccccagcggtctgggcccaggcaccgtctgagtcg
ggtgtttgggaaggcgttcgcttggtgggttaggcctgtgtgttgcttagccgaaagagg
catcgttttctctttaggtgagaagggtttcggggtatcggcgcaaggctccgacggggg
EXON 2  113 bp
ttctttaatattttttctttctacacccacaactgtaacatttcccttagtttttacttt
gaatgtgcatactcttacacgacttacagtatggctatattttcagtttgctagagcttt
acaattaatttaaaacatgaaaggctaattaagggaattctttaaattttgttttaatag
TGAAAGCAAGTTGAATACATTGGTGCAGAAGCTTCATGACTTCCTTGCACACTCATCAGA
AGAATCTGAAGAAACAAGTTCTCCTCCACGACTTGCAATGAATCAAAACACAG
gtaaattgaaaaagaatgtgctataccttctagtcttttttctattttttttttacactt
atggaggtaaccatttattttattcagagagcagcttttaaaagagatttcagtttgtgg
aaaatgacagattagcaagctttatagaagcccctattatgtatcttagctatatctgat
EXON 3  56 bp
gcaaaaggagagtgattctagtgaaagaacacttctaggaatattttaatgtgagtagta
tgttaacaatactgccagacttcatagtgtgagaatgggtttgtggagttataggtattg
atgttctgtttgataatgcatcgaagagataaataatgttctttatttcttcttttttag
ATAAAATCAGTGGTTCTGGAAGTAACTCTGATATGATGGAAAACAGCAAGGAAGAG
gtaaggataattatttagagatatttgttagttacgattaaccaagtagagcatatgtct
ttagattgcttctggacacatgtatgtgtcgaaggctactgatacccagttgtcattata
cttcagtttcgttgttttccagtttgagaacaggtgttcattgtttctgttattgttgtg
EXON 4  53 bp
catctgtgttccttatgtggtagagaattagtttttgaagttccttttagaaaaatattc
taggcacataaatagcatctcattatatcactgtattgaagttgctatagggaaatagct
aattgtagggatgccgtttcgagaattttattcacttttatatttatgtctcacatctag
GGAACTAGCTCTTCAGAAAAATCCAAGTCTTCAGGATCGTCACGATCAAAGAG
gttggttgatgttgaagggacaaaaagttattttctttttcaggttattttctgtttcta
aaaccatgtttttttctgaactcatgtcaaccactattctgagttaactattctatacaa
atatacatatttgaaaatgattagcataatataatgaatccctttgtatctatcacctga
EXON 5  128 bp
cagacctactgaatcataatcttcagtgatatggtatagacatacatgcttccctaggtg
attctgatgtgcttccttgttgagacccactgctcaatctcaacatgttatttatgttct
ttgggtattgttccagttgtcagaaacattcataattctatgaacttaattctttcatag
GAAACCTTCAATTGTAACAAAGTATGTAGAATCAGATGATGAAAAACCTTTGGATGATGA
AACTGTAAATGAAGATGCGTCTAATGAAAATTCAGAAAATGATATTACTATGCAGAGCTT
GCCAAAAG
gtaatgtgtgttaatttttcatgaagttaaagttgaaatgaatttttaaacatcattttt
ataaaattggaacttgattactgttaactatgtacaaacgaccaaacatggcattttcct
agtggttgtctagaaatatatttgtatgccaatgataatatgtgttattgaagttaaaaa
EXON 6  114 bp
acacctggcccttttactatttccctgttttatttacttttgtgaggtccttacaccaat
atctaaagcttgaaagaaacaaactatgtaccagcaatgttggctttatctgaactgaag
tcttgtacttcacttgcacatttaatatgtgtaatggttttttaaatgaaatcattctag
GTACAGTGATTGTACAGCCAGAGCCAGTGCTGAATGAAGACAAAGATGATTTTAAAGGGC
CTGAATTTAGAAGCAGAAGTAAAATGAAAACTGAAAATCTCAAAAAACGCGGAG
gtaaatacaagtgaaaatgaaacatgaatttaaattgctgtttatgaccatattggaaaa
tcggatgtgcttactaaaaatacctccacttttctgccttttgtttattaaaagcactac
ttaaatataacttctgtttctctctgagctctgaagcagaaaaggttaagcaccatttat
EXON 7  123 bp
atatcatttgggaacgtttttcatttaacattgtttttgaattgtattcatgtcagtaaa
tgtacatctagtttgtttatttttcactgctctatagaattatgttatatcaataagcca
ctattcatttcccacataggaagttattcccaatttttcattttctaattttctaattag
TGCTGTGGTGAATATCCTTATATTTGATTCCTTGTGCACATGTGGGAGAAAATCTCCAAA
GAATTACCTAGTTTTGTTTAATTCTTGAGCGATGTATGCACCAAAGCACATAGAAGATAC
TTA
gtaagtattacttaacactggatgaacattcagattctacattttatttatcttgttagt
ttatctgaatgaaatcattgtttgaaatgaaaaagtatggtgtggtgtatttgtttctgt
taaaacaaatacagaatatatgaatacccaagatcaaactggtgtttgtaaataatgtga
EXON 8  110 bp
ggttgtcatgtgcttagtaagtcgataaaatattaaccttttttacttgtgtccaatatg
ccatttttctaaggattatgaggtatttcatgtctaatacaaaagttacaaaatgctgac
taaagtaagtatctttttctgtgtataaatgtgtgaataatagccactcctttctcctag
AAGATGGGCTTCATGGGATTGTGAGCTGCACTGCTTGTGGACAACAGGTCAATCATTTTC
AAAAAGATTCCATTTATAGACACCCTTCATTGCAAGTTCTTATTTGTAAG
gtatgtaatgatctgttgatatttcataccgtaaatatttgaatgcttaccatataccag
gcctttgagggcacagtcttgaagaaagatgaaaatggtatctgcccttggaagacttct
actatagtggggaaaatagacgtacaaagcctaagtgtcatgataggggagatactgtga
EXON 9  68 bp
tttgccaatttttgctttggttgcctgagcttgtgtaatatgctcaataaatctttgccc
acaccagtgtcctggagattttccccagtgtttttaattacttaaaaaaataaagttttt
gtcctttatgaatgttatcaattttgaattaaatttccccttcctcttttcttttaatag
AATTGCTTTAAGTATTACATGAGTGATGATATTAGCCGTGACTCAGATGGAATGGATGAA
CAATGTAG
gtaggtaatatagatgagctaacattcagtgtttcctacttttgggaggaattgttacat
aatcatttatgaggtttgtctttcatagtatcgtcattgatgtctttaatgaaaggttgt
tcttttccataaaaccctggatttatgtctagtttaagtttctaataaagagtaagcaga
EXON 10  3074 bp
taaagagtaagcagatgacctaaattaccactaaaattactggcagtaaaatttaaattg
cattataacaaagagattaaaatgagttttgttgggaataatgtttatttttattttttt
acatatcttttcagtttcctgaaagaagggaataatgttttaatctttaaaacatttcag
GTGGTGTGCGGAAGGTGGAAACTTGATTTGTTGTGACTTTTGCCATAATGCTTTCTGCAA
GAAATGCATTCTACGCAACCTTGGTCGAAAGGAGTTGTCCACAATAATGGATGAAAACAA
CCAATGGTATTGCTACATTTGTCACCCAGAGCCTTTGTTGGACTTGGTCACTGCATGTAA
CAGCGTATTTGAGAATTTAGAACAGTTGTTGCAGCAAAATAAGAAGAAGATAAAAGTTGA
CAGTGAAAAGAGTAATAAAGTATATGAACATACATCCAGATTTTCTCCAAAGAAGACTAG
TTCAAATTGTAATGGAGAAGAAAAGAAATTAGATGATTCCTGTTCTGGCTCTGTAACCTA
CTCTTATTCCGCACTAATTGTGCCCAAAGAGATGATTAAGAAGGCAAAAAAACTGATTGA
GACCACAGCCAACATGAACTCCAGTTATGTTAAATTTTTAAAGCAGGCAACAGATAATTC
AGAAATCAGTTCTGCTACAAAATTACGTCAGCTTAAGGCTTTTAAGTCTGTGTTGGCTGA
TATTAAGAAGGCTCATCTTGCATTGGAAGAAGACTTAAATTCCGAGTTTCGAGCGATGGA
TGCTGTAAACAAAGAGAAAAATACCAAAGAGCATAAAGTCATAGATGCTAAGTTTGAAAC
AAAAGCACGAAAAGGAGAAAAACCTTGTGCTTTGGAAAAGAAGGATATTTCAAAGTCAGA
AGCTAAACTTTCAAGAAAACAGGTAGATAGTGAGCACATGCATCAGAATGTTCCAACAGA
GGAACAAAGAACAAATAAAAGTACCGGTGGTGAACATAAGAAATCTGATAGAAAAGAAGA
ACCTCAATATGAACCTGCCAACACTTCTGAAGATTTAGACATGGATATTGTGTCTGTTCC
TTCCTCAGTTCCAGAAGACATTTTTGAGAATCTTGAGACTGCTATGGAAGTTCAGAGTTC
AGTTGATCATCAAGGGGATGGCAGCAGTGGAACTGAACAAGAAGTGGAGAGTTCATCTGT
AAAATTAAATATTTCTTCAAAAGACAACAGAGGAGGTATTAAATCAAAAACTACAGCTAA
AGTAACAAAAGAATTATATGTTAAACTCACTCCTGTTTCCCTTTCTAATTCCCCAATTAA
AGGTGCTGATTGTCAGGAAGTTCCACAAGATAAAGATGGCTATAAAAGTTGTGGTCTGAA
CCCCAAGTTAGAGAAATGTGGACTTGGACAGGAAAACAGTGATAATGAGCATTTGGTTGA
AAATGAAGTTTCATTACTTTTAGAGGAATCTGATCTTCGAAGATCCCCACGTGTAAAGAC
TACACCCTTGAGGCGACCGACAGAAACTAACCCTGTAACATCTAATTCAGATGAAGAATG
TAATGAAACAGTTAAGGAGAAACAAAAACTATCAGTTCCAGTGAGAAAAAAGGATAAGCG
TAATTCTTCTGACAGTGCTATAGATAATCCTAAGCCTAATAAATTGCCAAAATCTAAGCA
ATCAGAGACTGTGGATCAAAATTCAGATTCTGATGAAATGCTAGCAATCCTCAAAGAGGT
GAGCAGGATGAGTCACAGTTCTTCTTCAGATACTGATATTAATGAAATTCATACAAACCA
TAAGACTTTGTATGATTTAAAGACTCAGGCGGGGAAAGATGATAAAGGAAAAAGGAAACG
AAAAAGTTCTACATCTGGCTCAGATTTTGATACTAAAAAGGGCAAATCAGCTAAGAGCTC
TATAATTTCTAAAAAGAAACGACAAACCCAGTCTGAGTCTTCTAATTATGACTCAGAATT
AGAAAAAGAGATAAAGAGCATGAGTAAAATTGGTGCTGCCAGAACCACCAAAAAAAGAAT
TCCAAATACAAAAGATTTTGACTCTTCTGAAGATGAGAAACACAGCAAAAAAGGAATGGA
TAATCAAGGGCACAAAAATTTGAAGACCTCACAAGAAGGATCATCTGATGATGCTGAAAG
AAAACAAGAGAGAGAGACTTTCTCTTCAGCAGAAGGCACAGTTGATAAAGACACGACCAT
CATGGAATTAAGAGATCGACTTCCTAAGAAGCAGCAAGCAAGTGCTTCCACTGATGGTGT
CGATAAGCTTTCTGGGAAAGAGCAGAGTTTTACTTCTTTGGAAGTTAGAAAAGTTGCTGA
AACTAAAGAAAAGAGCAAGCATCTCAAAACCAAAACATGTAAAAAAGTACAGGATGGCTT
ATCTGATATTGCAGAGAAATTCCTAAAGAAAGACCAGAGCGATGAAACTTCTGAAGATGA
TAAAAAGCAGAGCAAAAAGGGAACTGAAGAAAAAAAGAAACCTTCAGACTTTAAGAAAAA
AGTAATTAAAATGGAACAACAGTATGAATCTTCATCTGATGGCACTGAAAAGTTACCTGA
GCGAGAAGAAATTTGTCATTTTCCTAAGGGCATAAAACAAATTAAGAATGGAACAACTGA
TGGAGAAAAGAAAAGTAAAAAAATAAGAGATAAAACTTCTAAAAAGAAGGATGAATTATC
TGATTATGCTGAGAAGTCAACAGGGAAAGGAGATAGTTGTGACTCTTCAGAGGATAAAAA
GAGTAAGAATGGAGCATATGGTAGAGAGAAGAAAAGGTGCAAGTTGCTTGGAAAGAGTTC
AAGGAAGAGACAAGATTGTTCATCATCTGATACTGAGAAATATTCCATGAAAGAAGATGG
TTGTAACTCTTCTGATAAGAGACTGAAAAGAATAGAATTGAGGGAAAGAAGAAATTTAAG
TTCAAAGAGAAATACTAAGGAAATACAAAGTGGCTCATCATCATCTGATGCTGAGGAAAG
TTCTGAAGATAATAAAAAGAAGAAGCAAAGAACTTCATCTAAAAAGAAGGCAGTCATTGT
CAAGGAGAAAAAGAGAAACTCCCTAAGAACAAGCACTAAAAGGAAGCAAGCTGACATTAC
ATCCTCATCTTCTTCTGATATAGAAGATGATGATCAGAATTCTATAGGTGAGGGAAGCAG
CGATGAACAGAAAATTAAGCCTGTGACTGAAAATTTAGTGCTGTCTTCACATACTGGATT
TTGCCAATCTTCAG
gtatgcaaaaataaataaaaaattcataatttgtacttccccctcttgagttactacatt
gtttaatttcctctgaagctaatcaaatttagggttactacttaggagaataccacttaa
aaattatttaggagtttattaaaaaaagtttccctatttatttttatgctgccattggaa
EXON 11  73 bp
ggcacttcacaaataacctgttatgttttctataagaatgctttttactcatattttgga
gtccagagtttagaccccacttagtttgctttaaagtttttggctttcagttttatttta
catggttttaattatatagcttatttaaagctaattttaagtacacttttttccctcaag
GAGATGAAGCCTTATCTAAATCAGTGCCTGTCACAGTGGATGATGATGATGACGACAATG
ATCCTGAGAATAG
gtatgattccatctgtaaggactttaaaaagattataacacaccctaggcatgggcacaa
acagcagcaacggaacagcaagcaggttgtaaaaaccaggagtgcctgccttagaaagac
tcgctcacagtcttcctgcaagtttgaaagaaaggccagaaaatgggctaaaactcagaa
EXON 12  134 bp
ttaaaagtttttgtttatagcttaggttaaaacatggttttgctagttgtttatttacaa
tataaaatctattggcacatttatttctattttgattcaaagaagtctgtttttattttt
aatttggtgtatttcacccccagatatatagttctttttttattgttttttactctcaag
AATTGCCAAGAAGATGCTTTTAGAAGAAATTAAAGCCAATCTTTCCTCTGATGAGGATGG
ATCTTCAGATGATGAGCCAGAAGAAGGGAAAAAAAGAACTGGAAAACAAAATGAAGAAAA
CCCAGGAGATGAGG
gtgagctccccagagagaagtttataatgtcataatttgattccttgactaattcagtct
ttgaagaatatctgaccaagaaatatcttaatatggcccggcgtggtggctcacgcctat
aatctcaggactttgggaggccaaagcaggtggatcacttgaggttaagagtttgagacc
EXON 13  177 bp
ttaataatagtaatatgtcaagtctgatgtgtgagattacctgataacaccaatgatacc
aaagtatgtgtctaactctgatttttttcataagttgcagtagttgtcaacaggcaaaat
agatatacgaggcattttaaaggctgaagaaggttttattgatttatttccttcatttag
AAGCAAAAAATCAAGTCAATTCTGAATCAGATTCAGATTCTGAAGAATCTAAGAAGCCAA
GATACAGACATAGGCTTTTGCGGCACAAATTGACTGTGAGTGACGGAGAATCTGGAGAAG
AAAAAAAGACAAAGCCTAAAGAGCATAAAGAAGTCAAAGGCAGAAACAGAAGAAAGG
gtaagatgttttaattctgaatgtaaagaacatattggaccagacagtggcttatgcctg
taatcctagcactttgggaagctgaggtgggcagattgcttgagcccaggagtttaagac
cagcctgggcaacatagggaaacctcatctttatgaaaaatagaagaaatagctgggtgt
EXON 14  94 bp
ttttatgtatatcatgtaaagcattaactggtatattctatattatgtattatccattca
catatatacctctgatgttcttacaatgctctgttttaatgtcgagtcagtggtaaatta
agtgaattaggtttctattgaaaaataattaataattttatgtattttttaaaattcaag
TGAGCAGTGAAGATTCAGAAGATTCTGATTTTCAGGAATCAGGAGTTAGTGAAGAAGTTA
GTGAATCCGAAGATGAACAGCGGCCCAGAACAAG
gtattataattggtttttaaaaaattttaggaattaatctgaatgaccatgccttcaaat
gatttatatggttactgttaccaataaagttaagttagtgtgatatataatattttgatt
tgaaactaattgttatacttaatagtttaaaaagaatctaagcatattttatgtgtagtt
EXON 15  103 bp
atcattggattaaaatgaagggttaggctgctgctggaatatccattttgaacctattga
ttttttttctgtttgtttttaggaatgcatacagaggtagaacagttttaaaatagtaca
taacttattgatggaagtttatcatgaaatattttattttgtgttttaaattttcgtcag
GTCTGCAAAGAAAGCAGAGTTGGAAGAAAATCAGCGGAGCTATAAACAGAAAAAGAAAAG
GCGACGTATTAAGGTTCAAGAAGATTCATCCAGTGAAAACAAG
gtaataatgacatttaccacatgcttgaattataaccagtacagtagactatggtaatta
tgctgttacctctctgttccattcattcattgtattgtactggcttatttacattttaca
cttgtggaaggattggttattgaatatatatatgtaaaagtattgatttgacattatcat
EXON 16  240 bp
caccgtgcccggccgaagagttgtttttttttttttaatactactctattgctgaatata
attctaaaggttttcagcatgttttcttccaccttttcctgctgtgttaattaatggaat
atgaaatggataaattaaatgactttgtactgtttacctctaattgtttaaattctgtag
AGTAATTCTGAGGAAGAAGAGGAGGAAAAAGAAGAGGAGGAGGAAGAGGAGGAGGAGGAG
GAAGAGGAGGAGGAAGATGAAAATGATGATTCCAAGTCTCCTGGAAAAGGCAGAAAGAAA
ATTCGGAAGATTCTTAAAGATGATAAACTGAGAACAGAAACACAAAATGCTCTTAAGGAA
GAGGAAGAGAGACGAAAACGTATTGCTGAGAGGGAGCGTGAGCGAGAAAAATTGAGAGAG

gtaactaatttctttcttcttctttttcttttgtagctacagggtcttgctctgttgccc
aggctggcctcgaactcttgggctcaagtgatcctcctaccttggcctcctaaacttctg
ggattacaggcgtgagtcaacacacccagccttaatttatttctattaatgatttatttt
EXON 17  142 bp
ccaacattggggattacaattaacatgagatttggtggggacacagatccaaatcatacc
aattggatttgtggtgtgggagtaaatgtgtctatattttggaaaatctcccttggtaag
actgaccattgcttgaatgatttctttgagcttaactatcaacaactccttttcttgtag
GTGATAGAAATTGAAGATGCTTCACCCACCAAGTGTCCAATAACAACCAAGTTGGTTTTA
GATGAAGATGAAGAAACCAAAGAACCTTTAGTGCAGGTTCATAGAAATATGGTTATCAAA
TTGAAACCCCATCAAGTAGATG
gtaagaaactattagatgattcaataatttttagttaaatttttaccaatatttgggtgt
gaggcagctgcctcacatcctgctaagtcctggaggtaaattggtgagtggggtggggaa
tccacaattcccctgcctttatggagctcataaacaaatgaggaagaacaaaattgggtg
EXON 18  110 bp
taacttgtttctgctttagtttggtgggaaaaaatcccatttagatgtaagaaattattt
agctaagtgtttttttaatgctgtttcttagaagttttggttatgtttttgatgtgttta
tgtaaaggaagtttttaacttggacctttaaatttaacttaatgaagctgttatttttag
GTGTTCAGTTTATGTGGGATTGCTGCTGTGAGTCTGTGAAAAAAACAAAGAAATCTCCAG
GTTCAGGATGCATTCTTGCCCACTGTATGGGCCTTGGTAAGACTTTACAG
gtaagagctgaagaatatgaaggtatcctgtttttgtggattcattaatatatattggat
tctattatgtttcaggcacagtcgtaggggctgaagataaagcagtgaacaagaataaca
agatctgtctccaaggagcttatattctagtggaggagagagctgctaatcaaataagaa
EXON 19  147 bp
tgatacatcatctagttgaactttggcattttactatctctttccctgtgccttgcctgg
tttggaaattctggccgtttattgtttaagcaaaacaaagctataatattgtaagattgc
ttaatttattaaatttttttgtggatatttaaacgaaggtgacaatctgttttcttatag
GTGGTAAGTTTTCTTCATACAGTTCTTTTGTGTGACAAACTGGATTTCAGCACGGCGTTA
GTGGTTTGTCCTCTTAATACTGCTTTGAATTGGATGAATGAATTTGAGAAGTGGCAAGAG
GGATTAAAAGATGATGAGAAGCTTGAG
gtaacttattttaaatgttttctattattaaaatagtcacatgaaattcatatagtaaac
tatttttaattttttttaatttttaatgttttttaaccagtgatgcatatttcagtggga
atatttaatattcacatgtttttagtagctacttaaaaaaatctttatttccccacaaaa
EXON 20  178 bp
taacttattttaaatgttttctattattaaaatagtcacatgaaattcatatagtaaact
atttttaattttttttaatttttaatgttttttaaccagtgatgcatatttcagtgggaa
tatttaatattcacatgtttttagtagctacttaaaaaaatctttatttccccacaaaag
GTTTCTGAATTAGCAACTGTGAAACGTCCTCAGGAGAGAAGCTACATGCTGCAGAGGTGG
CAAGAAGATGGTGGTGTTATGATCATAGGCTATGAGATGTATAGAAATCTTGCTCAAGGA
AGGAATGTGAAGAGTCGGAAACTTAAAGAAATATTTAACAAAGCTTTGGTTGATCCAG
gtaaggtattaatagacagtgacataaagaagcaagttgaataaaaaatgtgtttatatt
ttaacaaatagtaattgcacagctactaagtatctggtctttgttgtggttatccttcag
gtttttgccttttagaaaattcttagtatttcaatagaataaaatcacccttaatgtcgc
EXON 21  138 bp
tagttagtgctgtattaaccaaatacgggagcagataaaatatgtttatacttacaacga
tgtcattttatcttcctgtaagatcagcactttaaagggattaactttatttacttaaat
ggatcacattttcagttttattatatattaattgtgttatttttctgtttatttttgtag
GCCCTGATTTTGTTGTTTGTGATGAAGGCCATATTCTAAAAAATGAAGCATCTGCTGTTT
CTAAAGCTATGAATTCTATACGATCAAGGAGGAGGATTATTTTAACAGGAACACCACTTC
AAAATAACCTAATTGAGT
gtgagttaatatctctgattatgcagtagaatattggtatttcctcagatatatttttgt
aacgttaccatttacctttcttctacttattctagtatagtcctagaccatgatctacat
aggttcatcttagtctgctgtgaaagaataacatacttttcaaatgagatgctttataaa
EXON 22  176 bp
ttggtaattcacttgtagatcagacttataaccatgtttattctatacttagcttgatat
tctttctttatagcttaattctaatgcatgtgtttttgacatgagcatttcattggggaa
tttttctaagtctttttaacgattgttaatgttgttaatgaataatgtcttctctcttag
ATCATTGTATGGTTAATTTTATCAAGGAAAATTTACTTGGATCCATTAAGGAGTTCAGGA
ATAGATTTATAAATCCAATTCAAAATGGTCAGTGTGCAGATTCTACCATGGTAGATGTCA
GAGTGATGAAAAAACGTGCTCACATTCTCTATGAGATGTTAGCTGGATGTGTTCAG
gtacaaatatgttccatagtaataaaatattcttacttttttatataacaatcccaacat
attttctgagcttaaagtttaataattttgtgttttctttcccgctctttcagtagatag
ttttacagttatatctccttgcgttgtcttaaaaaatttctgctgcattcaacttttaaa
EXON 23  118 bp
aaatacattgtgtagataattgtgggtttagaaagggtaaatatatttaagaaaatgttt
tcttatatgtttagtgcctatttatttatgtgtatatttcagttataagcaatgagaact
tgtagttcattcctgttaaatatttagattaattttcattctctttcttgttaattacag
AGGAAAGATTATACAGCATTAACAAAATTCTTGCCTCCAAAACACGAATATGTGTTAGCT
GTGAGAATGACTTCTATTCAGTGCAAGCTCTATCAGTACTACTTAGATCACTTAACAG
gtaaacaatacaccttgttgatttcatcttctctataaagacattctttttccaaagaag
attatttcagtcatcttactatgtctgttgttctttttcagttttgcatttgaataaaat
gggtatgcttaaaagcataaaatatttctaattaaaacactgatgctgtcaaaattaaaa
EXON 24  131 bp
atgggtttcttttgtaatcctatttgttttatgtgtttcaaaacgatattccaagagaat
ttataagcttctctacactgccaaaagtgtttatgtcacaagtaagattaaaactcctaa
tctagaaacttggttgatatagacaatttttgtgtctttaaccatatttcttttgatcag
GTGTGGGCAATAATAGTGAAGGTGGAAGAGGAAAGGCAGGTGCAAAGCTTTTCCAAGATT
TTCAGATGTTAAGTAGAATATGGACTCATCCTTGGTGTTTGCAGCTAGACTACATTAGCA
AAGAAAATAAG
gtaagtcaggtaacttagtttaaaagcatctattggaagcagaataaacttagacaaaaa
attgacctacagactgtatattcaaattttctattgctttgttctattctatgtcttatt
tctaatttctatatgtcttgcatgtattatgattataggagtgttaaatgttattttatt
EXON 25  89 bp
acctcccattgcatttagtaagcatatctgtcctgtcttctttgtctactaaaatctgta
atagttcctcagtccttcctcagctcgtgccaattaacttattcttaaatgaacatcaat
ataatttccagtgtaagttgagatattctattaaaatagtggtcatttttttttctctag
GGTTATTTTGATGAAGACAGTATGGATGAATTTATAGCCTCAGATTCTGATGAAACCTCC
ATGAGTTTAAGCTCCGATGATTATACAAA
gtaaatcgaatactttttcgtgccatcctgtattgacaaagttaaaacccctacttgctg
attgacctcttataattgacgtttacatctttcctatgcttttctaacaatctgaatgtg
tttttttgtttgtttgtttgtttgtttttagaaagaagaaaaaagggaaaaaggggaaaa
EXON 26  170 bp
atgagtttaagctccgatgattatacaaagtaaatcgaatactttttcgtgccatcctgt
attgacaaagttaaaacccctacttgctgattgacctcttataattgacgtttacatctt
tcctatgcttttctaacaatctgaatgtgtttttttgtttgtttgtttgtttgtttttag
AAAGAAGAAAAAAGGGAAAAAGGGGAAAAAAGATAGTAGCTCAAGTGGAAGTGGCAGTGA
CAATGATGTTGAAGTGATTAAGGTCTGGAATTCAAGATCTCGGGGAGGTGGTGAAGGAAA
TGTGGATGAAACAGGAAACAATCCTTCTGTTTCTTTAAAACTGGAAGAAA
gtgagtctaatgaatgttgcctttatcatggaacagtaatttggaaaatgtcatgtcgtt
agtccttttttcagtcacttacctgactaattgactcaaaggaatctttcctcaattgat
gagtctaatcaagtactcataattacagtaaatatctgatgaatctttaattataagcaa
EXON 27  154 bp
gtctctgtccttctgtgctgtatgtgcgtgtgcctgcctttctcttttttccctcccctc
tcccaagtccccatcagtttctttcttactctccccatgggtaggtctttttctgtctct
cttgctctctttccatttcttttctaatttacctacttatgttccatttgtcttatttag
GTAAAGCTACTTCTTCTTCTAATCCAAGCAGCCCAGCTCCAGACTGGTACAAAGATTTTG
TTACAGATGCTGATGCTGAGGTTTTAGAGCATTCTGGGAAAATGGTACTTCTCTTTGAAA
TTCTTCGAATGGCAGAGGAAATTGGGGATAAAGT
gtaagtgctttaccatatttattatataaattaaccttttgattatgtttttattgctta
aacaatgtatttgaacaaatctgttgcttttccttccttcctaaagatgtgatttatttg
gtcattgtagtgctaggccaatacaagcaactatcttttttgtaagccactagttctgat
EXON 28  107 bp
ttgtcttccctcctctgaggtggcattctcatatacattttacaatcaccttgtaatttc
tacaaaaaaatcctgctgggatttttgttacaattgtgttaaatttgtagatcgatttag
gaagaagtgatatctttactaggaatcttctaatccataaacactaatctgtttttttag
CCTTGTTTTCAGCCAGTCCCTCATATCTCTGGACTTGATTGAAGATTTTCTTGAATTAGC
TAGTAGGGAGAAGACAGAAGATAAAGATAAACCCCTTATTTATAAAG
gtgagctacaaatatttctgtgtcgtaattttaaaaatactgatttaaacataccataca
aacattttagcaacaaaagaaacaaaactacccagtctcacaactctatcatatcaaaat
ttttttgcaatgtctatttgtccttatccatatatatgtatagtctttttcaaaataaaa
EXON 29  109 bp
tggttaatttatttataatgtaatgactccttgattaagaaaagtatataatgtattttg
ctatacaaatagaatatatataacccacttttaaatgatgagcaaggtggaaaatctgtt
cttaccagtaagcagagcgatatatcaaattccttttgtgttcttttgttaaattttcag
GTGAGGGGAAGTGGCTTCGAAACATTGACTATTACCGTTTAGATGGTTCCACTACTGCAC
AGTCAAGGAAGAAGTGGGCTGAAGAATTTAATGATGAAACTAATGTGAG
gtaggaaaaattttctgtatatgtagaaacattaaaataattaattttaaaatttacata
aagttcactatttttattgtgtatttgaatgtttttagcaaatgcaaggtacagtcaggt
tgcaaaacagtgtcatcactccctaaccactgaattcacttatggaatcatataatttgt
EXON 30  178 bp
ggcatatgtattatcatcctgactccttagataatatattattttcttcagtaagtaaga
aatgaattctctgaactcttgatagttaaaaaaaaactaagtatcaaaaagtcatattgt
aattaaaatatttgtaaagtactaattactgaagcatttattctatattttcattttcag
AGGACGATTATTTATCATTTCTACTAAAGCAGGATCTCTAGGAATTAATCTGGTAGCTGC
TAATCGAGTAATTATATTCGACGCTTCTTGGAATCCATCTTATGACATCCAGAGTATATT
CAGAGTTTATCGCTTTGGACAAACTAAGCCTGTTTATGTATATAGGTTCTTAGCTCAG
gtaggtttataattctctttttcatattgaaagtttatgtgaaactgataatattttaga
gatatggaacatatgtgtattacagagagggaaacaaagttggaaataccatttctgtac
ataaagcagcagaagtcagttttggcttttcttgattttctgttttgtagtgtatccatt
EXON 31  195 bp
tgctaaacagatgaaatctttcatgaattaagcaaaattgctgatgagtttttctttatg
gcaatatactaccataaagttttaccatttcatattaaccagtaaccgtatttatccttg
attaagtttcatgcttacaaaattttatttttttgtatattcttccttctttttacaaag
GGAACCATGGAAGATAAGATTTATGATCGGCAAGTAACTAAGCAGTCACTGTCTTTTCGA
GTTGTTGATCAGCAGCAGGTGGAGCGTCATTTTACTATGAATGAGCTTACTGAACTTTAT
ACTTTTGAGCCAGACTTATTAGATGACCCTAATTCAGAAAAGAAGAAGAAGAGGGATACT
CCCATGCTGCCAAAG
gtaaacatatttagattattggcttaacaaaccaacgtggactaaggaaattttactact
gatatcaaatttagtcatctgattaaggctatatttcagaatttttcaaggataataaaa
tgatatttaatgaattttgtctagaaaattataaatgatagggtgcttgatctgttctcc
EXON 32  150 bp
tacataagaggctggtgttacatgttttgctgctgttttttaggtaatctgtcatatata
tcagaaatatatatagcaatcaggttttagtttctagtacagttgaccatagaactatgg
agatattatactgtccagaggggaaaaataattgtctcttatttcaacccctctaaacag
GATACCATACTTGCAGAGCTCCTTCAGATACATAAAGAACACATTGTAGGATACCATGAA
CATGATTCTCTTTTGGACCACAAAGAAGAAGAAGAGTTGACTGAAGAAGAAAGAAAAGCA
GCTTGGGCTGAGTATGAAGCAGAGAAGAAG
gtagttgatgcaaaatgtgtttttgtttttgttatgttagtgatttgaaagagcaatgaa
gaagaaaagggtcacatttgaaacaggtaataataatatagtgggttttaggaacacatt
ccccaattacaagaatctctttatgggttggtttcagctacctttagtggtagagtagga
EXON 33  126 bp
taaagctttccttgtaataagatcttggtttcgggtgaaaagggtgttttgtttgtgtgt
ggaagagtgttaataatttcctggatctgagaatgtggattcttttctaaaccagtaggt
gatgtagaatttcaagttttaaatcacaatgtgaaaagtgcataatttttttgtttttag
GGACTGACCATGCGTTTCAACATACCAACTGGGACCAATTTACCCCCTGTCAGTTTCAAC
TCTCAAACTCCTTATATTCCTTTCAATTTGGGAGCCCTGTCAGCAATGAGTAATCAACAG
CTGGAG
gtgagttgtgaagtacaaaagtagtttgacatgaattaaaggcaatttcaagtgccttgt
tgttgagggttccctatgcagaaatatcacattctccaaaagattacccctgaatagacg
aataaatttttgttttatttgttgaccgttttgaaccaacatgatgttgtaaaatgtggt
EXON 34  96 bp
gactctttgagcattgatatggtttactccactttattgatactgaattttgctgttctc
ttcaattatttaaagagttttaaaaccgactgctctaagttggcaaatggaaggattccc
tatactttaacactatgctgtctttctgccttatataacttatttcttgcattcttctag
GACCTCATTAATCAAGGAAGAGAAAAAGTTGTAGAAGCAACAAACAGTGTGACAGCAGTG
AGGATTCAACCTCTTGAGGATATAATTTCAGCTGTA
gtaagctaattggcaattgtcttattccaacctccaatttgtaccctccaccccctactg
ccatttttttaaatttttaattgttccttcttataaattgatttgcaatagtaaaatact
ggtaaaatggatggataatgccaaaccgtaacccagcaattttacatagatgttggcaca
EXON 35  129 bp
ccagcccaggtacagcagtgaacaacttagtaccctgttttgcatcatgtttttcttcag
aaaagaataaaggaaaaggggggtttgaaaccttgggaaatcccgaatatcttaaaatac
cttaattatttttcctcaattgtacagtaataaggagtaaatagaaaatttttcttttag
TGGAAGGAGAACATGAATCTCTCAGAGGCCCAAGTACAGGCGTTAGCATTAAGTAGACAA
GCCAGCCAGGAGCTTGATGTTAAACGAAGAGAAGCAATCTACAATGATGTATTGACAAAA
CAACAGATG
gtaagaattctgacgtctgactatttctaggttatgtttaattttcttgactttataata
agtttgtatgacatctacgtcagtaattattcctactatggagggatggatagtcattga
taattctggaagaaatgtaaaaaacccaggaatgtcaagtaaaagtaatatattttgtta
EXON 36  2917 bp
ttactaactggtttctacagtaatggtcctgtgaatgccatcacattagtaatggtgtta
acaataatgtgttttccttttggtatggtacccccttaacaaattgattttaagtcaaaa
cttgatacctcttttgagacaggtcatgcacttgtaatgactcccattttttctctatag
TTAATCAGCTGTGTTCAGCGAATACTTATGAACAGAAGGCTCCAGCAGCAGTACAATCAG
CAGCAACAGCAACAAATGACTTATCAACAAGCAACACTGGGTCACCTCATGATGCCAAAG
CCCCCAAATTTGATCATGAATCCTTCTAACTACCAGCAGATTGATATGAGAGGAATGTAT
CAGCCAGTGGCTGGTGGTATGCAGCCACCACCATTACAGCGTGCACCACCCCCAATGAGA
AGCAAAAATCCAGGACCTTCCCAAGGGAAATCAATGTGATTTTGCACTAAAAGCTTAATG
GATTGTTAAAATCATAGAAAGATCTTTTATTTTTTTAGGAATCAATGACTTAACAGAACT
CAACTGTATAAATAGTTTGGTCCCCTTAAATGCCAATCTTCCATATTAGTTTTACTTTTT
TTTTTTTTAAATAGGGCATACCATTTCTTCCTGACATTTGTCAGTGATGTTGCCTAGAAT
CTTCTTACACACGCTGAGTACAGAAGATATTTCAAATTGTTTTCAGTGAAAACAAGTCCT
TCCATAATAGTAACAACTCCACAGATTTCCTCTCTAAATTTTTATGCCTGCTTTTAGCAA
CCATAAAATTGTCATAAAATTAATAAATTTAGGAAAGAATAAAGATTTATATATTCATTC
TTTACATATAAAAACACACAGCTGAGTTCTTAGAGTTGATTCCTCAAGTTATGAAATACT
TTTGTACTTAATCCATTTCTTGATTAAAGTGATTGAAATGGTTTTAATGTTCTTTTGACT
GAAGTCTGAAACTGGGCTCCTGCTTTATTGTCTCTGTGACTGAAAGTTAGAAACTGAGGG
TTATCTTTGACACAGAATTGTGTGCAATATTCTTAAATACTACTGCTCTAAAAGTTGGAG
AAGTCTTGCAGTTATCTTAGCATTGTATAAACAGCCTTAAGTATAGCCTAAGAAGAGAAT
TCCTTTTTCTTCTTTAGTCCTTCTGCCATTTTTTATTTTCAGTTATATGTGCTGAAATAA
TTACTGGTAAAATTTCAGGGTTGTGGATTATCTTCCACACATGAATTTTCTCTCTCCTGG
CACGAATATAAAGCACATCTCTTAACTGCATGGTGCCAGTGCTAATGCTTCATCCTGTTG
CTGGCAGTGGGATGTGGACTTAGAAAATCAAGTTCTAGCATTTTAGTAGGTTAACACTGA
AGTTGTGGTTGTTAGGTTCACACCCTGTTTTATAAACAACATCAAAATGGCAGAACCATT
GCTGACTTTAGGTTCACATGAGGAATGTACTTTTAACAATTCCCAGTACTATCAGTATTG
TGAAATAATTCCTCTGAAAGATAAGAATCACTGGCTTCTATGCGCTTCTTTTCTCTCATC
ATCATGTTCTTTTACCCCAGTTTCCTTACATTTTTTTAAATTGTTTCAGAGTTTGTTTTT
TTTTTAGTTTAGATTGTGAGGCAATTATTAAATCAAAATTAATTCATCCAATACCCCTTT
ACTAGAAGTTTTACTAGAAAATGTATTACATTTTATTTTTTCTTAATCCAGTTCTGCAAA
AATGACCTATAAATTTATTCATGTACAATTTTGGTTACTTGAATTGTTAAAGAAAACATT
GTTTTTGACTATGGGAGTCAACTCAACATGGCAGAACCATTTTTGAGATGATGATACAAC
AGGTAGTGAAACAGCTTAAGAATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAACTG
GGTTTGGGCTTTGCTTTAGGTATCACTGGATTAGAATGAGTTTAACATTAGCTAAAACTG
CTTTGAGTTGTTTGGATGATTAAGAGATTGCCATTTTTATCTTGGAAGAACTAGTGGTAA
AACATCCAAGAGCACTAGGATTGTGATACAGAATTTGTGAGGTTTGGTGGATCCACGCCC
CTCTCCCCCACTTTCCCATGATGAAATATCACTAATAAATCCTGTATATTTAGATATTAT
GCTAGCCATGTAATCAGATTTATTTAATTGGGTGGGGCAGGTGTGTATTTACTTTAGAAA
AAATGAAAAAGACAAGATTTATGAGAAATATTTGAAGGCAGTACACTCTGGCCAACTGTT
ACCAGTTGGTATTTCTACAAGTTCAGAATATTTTAAACCTGATTTACTAGACCTGGGAAT
TTTCAACATGGTCTAATTATTTACTCAAAGACATAGATGTGAAAATTTTAGGCAACCTTC
TAAATCTTTTTCACCATGGATGAAACTATAACTTAAAGAATAATACTTAGAAGGGTTAAT
TGGAAATCAGAGTTTGAAATAAAACTTGGACCACTTTGTATACACTCTTCTCACTTGACA
TTTTAGCTATATAATATGTACTTTGAGTATAACATCAAGCTTTAACAAATATTTAAAGAC
AAAAAAATCACGTCAGTAAAATACTAAAAGGCTCATTTTTATATTTGTTTTAGATGTTTT
AAATAGTTGCAATGGATTAAAAATGATGATTTAAAATGTTGCTTGTAATACAGTTTTGCC
TGCTAAATTCTCCACATTTTGTAACCTGTTTTATTTCTTTGGGTGTAAAGCGTTTTTGCT
TAGTATTGTGATATTGTATATGTTTTGTCCCAGTTGTATAGTAATGTTTCAGTCCATCAT
CCAGCTTTGGCTGCTGAAATCATACAGCTGTGAAGACTTGCCTTTGTTTCTGTTAGACTG
CTTTTCAGTTCTGTATTGAGTATCTTAAGTACTGTAGAAAAGATGTCACTTCTTCCTTTA
AGGCTGTTTTGTAATATATATAAGGACTGGAATTGTGTTTTTAAAGAAAAGCATTCAAGT
ATGACAATATACTATCTGTGTTTTCACCATTCAAAGTGCTGTTTAGTAGTTGAAACTTAA
ACTATTTAATGTCATTTAATAAAGTGACCAAAATGTG
ttgtgctctttattgtattttcacagctttgaaaatctgtgcacatactgtttcatagaa
aatgtatagcttttgttgtcctatataatggtggttcttttgcacatttagttatttaat
attgagaggtcacgaagtttggttattgaatctgttatatactaaattctgtaaagggag