Gene ARX Variant 1
DNA : 11.56 KbNT_011757
mRNA : 2184 bp NM_139058
CDS : 1689 bp NP_620689
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  196 bp
ccgcgggcagggcgggagccggcagccggcaaccaagggaggcagaaaggcacaaagatc
gcaataatatccgttataacccgctatctaaccccacccccaacacacacccatccatcc
caccctccgggagaggcagccggcgatccgctctctgcgccctgggaaaaagccccagcc
ATGAGCAATCAGTACCAGGAGGAGGGCTGCTCCGAGAGGCCCGAGTGCAAAAGTAAATCT
CCAACTTTGCTCTCCTCCTACTGCATCGACAGCATCCTGGGCCGGAGGAGCCCGTGCAAA
ATGCGGTTGCTGGGAGCCGCGCAGAGCTTGCCTGCTCCGCTGACCAGCCGCGCCGACCCG
GAAAAGGCCGTGCAAG
gtaaggatgctcccgtcaggcacttactaagggcattgggccctgatttggatgtttggt
gttcgggggccagtggcctggaattgtcaatttggagaggaaggaaggagagggcataac
tctgaggcctgctgcctcaaagagcgttaaacatctagccagggctgtctctccctccct
EXON 2  877 bp
aagaaaaagaaaaagcaagaaaagtggagaaagaggccaaggcgtcgaagtctggtggtg
cgcggtccccgcacgcctgggcctaggcactgggggagcaactgcgggcgggccccggca
gcagccctggctgggactccccggccggccggctggctgatagctctcccttgcccgcag
GCTCCCCTAAGAGCAGCAGCGCCCCGTTCGAGGCCGAGCTGCACCTGCCGCCCAAGCTGC
GGCGCCTGTACGGCCCGGGCGGGGGCCGCCTCCTTCAGGGTGCGGCAGCGGCGGCGGCGG
CGGCGGCGGCGGCGGCGGCAGCGGCCGCCACGGCCACGGCGGGTCCACGCGGGGAGGCCC
CTCCGCCGCCACCGCCAACCGCGCGGCCCGGGGAACGGCCGGACGGCGCAGGGGCCGCCG
CGGCAGCCGCGGCCGCGGCCGCCGCGGCCTGGGACACGCTCAAGATCAGCCAGGCGCCGC
AGGTGAGCATCAGCCGCAGCAAGTCGTACCGCGAGAACGGGGCGCCCTTCGTGCCGCCGC
CGCCCGCGCTGGACGAGCTGGGCGGCCCGGGGGGCGTCACGCACCCGGAGGAGCGCCTCG
GCGTGGCCGGCGGCCCGGGCAGCGCCCCGGCTGCGGGTGGTGGCACCGGCACCGAGGACG
ACGAGGAGGAGCTGCTGGAGGACGAAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGG
ACGACGAGGAGGAGCTGCTGGAGGACGACGCCCGCGCGCTGCTCAAGGAGCCCCGGCGCT
GTCCTGTGGCCGCCACTGGCGCCGTGGCCGCAGCAGCTGCCGCTGCAGTGGCCACAGAGG
GCGGGGAGCTGTCACCCAAGGAGGAGCTGCTGCTGCACCCGGAAGACGCTGAGGGCAAGG
ACGGCGAGGACAGCGTGTGCCTCTCTGCGGGCAGCGACTCGGAGGAGGGGCTGCTGAAAC
GCAAACAGAGGCGCTACCGCACCACGTTCACCAGCTACCAGCTGGAGGAACTGGAGCGGG
CCTTCCAGAAGACGCACTACCCGGACGTCTTCACCAG
gtatgcgcgtagggtggtcgcggtcgcagcggcagagagcgcacgcgggccccagggagg
gacagcgggctggcaggggccccggcctcggggcggacgcttggctcctggactctgtgg
aagagcgccctcccaacacacccacccttgctcacccaaactacccactcccccgacccc
EXON 3  46 bp
tcagtcaaatagttggcactccagggggtgatggaatggtaatgcccatatgtttggggg
tggggggcaggcagccaggggagaccctggtggagtaggcctgccatagaggaggaaata
gctgagagggcattgctggggcctgcagtgacctcctgtctgtgtgttgctttcttatag
GGAGGAACTGGCCATGAGGCTGGACTTGACCGAGGCCCGAGTCCAG
gtgagctgcacaacagagggaagagggagggaggagggctgggggccagtgggagagaga
gagatgggttggtggcgggggggtgcggggggtgagatccccttcacaaaaccaagagaa
gcaggatcagaaaagtagacccaagcactctctcacacacaaagatatttaaaacttaag
EXON 4  329 bp
cactgctcatttggccccagacgcgtccgaaaacaacctgaggccaaagaggggcaggtg
ggcgcgggccgcggtggaaaggaagggggccccgcagcgcgccaagggaagggacgggta
ggggcccggtgcgcccgccgggccgagccgcgccgaccctgggctctctctgccttgcag
GTCTGGTTCCAGAACCGTCGGGCCAAGTGGCGCAAGCGGGAGAAGGCAGGCGCGCAGACC
CACCCCCCTGGGCTGCCCTTCCCGGGGCCGCTCTCCGCCACCCACCCGCTCAGCCCCTAC
CTGGACGCCAGCCCCTTCCCTCCGCACCACCCGGCGCTCGACTCCGCTTGGACTGCCGCT
GCCGCCGCCGCCGCCGCCGCCTTCCCGAGCCTACCTCCGCCTCCGGGCTCGGCCAGCCTG
CCGCCCAGCGGGGCGCCGCTGGGCCTGAGCACTTTCCTCGGAGCGGCAGTGTTCCGACAC
CCAGCTTTCATCAGCCCGGCATTCGGCAG
gtaacgcgcagcctcggaagtctgtctgtctgtctgtctctcatacacacagaggctggg
ggcagggaggaggcaggagtcaaacagggttacacacatctttttctttgacccaacctc
agagactgtagccaaagaaaatactctctaattgagcctcaaaaaaaaaaatgtgggtct
EXON 5  736 bp
gccctctctgcggggtccagcttccgcccgcgccctctgcccacttccccgccgcggccc
atccgggtcccgtgggtaccgcgcccctcagctgccccggcgacaagcggcgggagacgc
tgcccgaggcgccgcgcacagctcccgaggccatgaccgcgctgtttgctctccctgcag
GCTCTTTTCCACAATGGCCCCCCTGACCAGCGCGTCGACCGCGGCCGCGCTCCTGAGACA
GCCCACACCCGCCGTGGAGGGCGCAGTGGCATCGGGCGCCCTGGCCGACCCGGCCACGGC
GGCCGCAGACAGACGCGCCTCTAGCATAGCCGCGCTGAGGCTCAAGGCCAAGGAGCACGC
GGCGCAGCTCACGCAGCTCAACATCCTGCCGGGCACCAGCACGGGCAAGGAGGTGTGCTA
AAGGCTGCCCTCCACACCCGCGCCCCGCGCGCGCCCCGAAAGGTCACCTCACTCAGCACC
ACTCAAGACCAAATGGAAACAGAGGACCAGCACACTCCCGAGACGGCACTGAGAGAGCGC
AGCCGCCTTCACAGCAGTCTGGATGCGGGCATGGCAGCCCTCGGCGCTCCGGGACGTGGC
ACCTCCTCGGCTGGCTGTCCACCCGCCCCTGCCCCTGCCCCTGCTACTGCCAACCTCGCT
CCAACTCCAACATCCACTCTCTCTTGTTCTTACTTTCCTGAAAATATCGGGGAGGTTTTC
TCCCCCAGACGCCTGATATTGAAGTAAAAAATTTAAAAAGCCCAACCTCTTCCTCCTGAC
ACCCCACTTAGCCTTTCTTTTCTTTCTTTCTTTCTTTCTTTTTTTTTTTTAAATAGCATT
TTGGCGCTCGAAGTTGATCTCCCCAGCGAGGGCCCCAGCGTGAAGCCAGGGCCCGGGAAG
CAAATGCGAGCCTGTA
agatagctaacagtgcacttaaaggaaaggggcgtcttgttcttgttctcttctttatca
tacaccaaccaaggtttttatatcaaaccaaagggaaataatactctgctagaatatgga
ctgttgaagtcaccaaactgtgattattgattctgtacataccattgttattaaaaaaaa