Gene ARSF Variant 1
DNA : 45.89 KbNT_025302
mRNA : 2012 bp NM_004042
CDS : 1773 bp NP_004033
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  61 bp
tgtgctgttgtttttcttttcctgggtgtgtagtaggagttgcaaatgcgggctgcagat
tagcaacgggaaccatctgggtgagcctagcagggaccagccctcccatgggagagagag
gtgacacggagcagctgatgctttcgtaatgattcgaggcagctgccaaaagaggcagag
CCTTTGCAGAACAGCCTGTCTGTTCTGCTCCTAGACATTAGAGAGATAATACGGCTGATA
G
gtgagttggggaaggcttgtttggacacattttctcagccttttttttttttttttaacc
tctggtagaaacgggcatagttgaaagatccattgacctattgtattctgaaactcaatg
gatcatcagcttaggcactgagaaatggattccaaaccaattttagtgtgagcaagtttc
EXON 2  39 bp
aaagttcaggatttgtgcagtagtggccttggaaaatcaatttaaaaatgtcggaattag
ggatatggctcacaagtctagtgtgaatttcatgctgggaactaatttaattgacacatg
aatgatactttttttttttttttttggtcttttaaatcacgtctgtgtcttctgccaaag
ACAACAAGAAGGTATTCCAAGCTGCACAATGAGGCCCAG
gtaggtaaagccatatactgcattgtgagcacattgaatctaatgtataattctgtgtat
ttgtgaatccagccttataggtagaggcatttaatatcatctgcctttttttcttttttc
tttttcttttcttgtaacctactatgagtcaacatgctgtctttatatggctggccataa
EXON 3  150 bp
gcacttccgctaccattcagcagcagtgctcggtgcttggagagagacactcttgagctt
caggagatgcctgggagatccacgtgatctccaaagacccctgttgtgttgtgttgggag
gtggatcctgaatccacccagagaagcctgataccaataaaatccctgcttgctttccag
GAGACCCTTGGTCTTCATGTCTTTGGTGTGTGCACTCTTGAACACATGCCAGGCACACAG
GGTGCATGACGACAAGCCTAATATTGTCCTAATCATGGTTGATGACCTGGGTATTGGAGA
TCTGGGCTGCTACGGCAATGACACCATGAG
gtaaggcggtttcatggccagtcatacgttcgtcagtcgttcaggttcagcaggctggct
gtacggctgcatctatgtgcaaaaccaaatgtatttgttgggacttttttttaagttact
ttaaactttttgatagttttaaattatttagattatgtaatagttttacaattacatttt
EXON 4  122 bp
ctgtctctctctctgcctcgctttctgggtctctccctctctccctgtctgtctctcctc
tctctttccacctgtgcctttctgtttgtccttctctgtcttcctctcgctcttcctctc
tgcttcccccgccccccaccttttccttctctccaatacaccttccctctcccccttcag
GACGCCTCACATCGACCGCCTTGCCAGGGAAGGCGTGCGACTGACTCAGCACATCTCTGC
CGCCTCCCTCTGCAGCCCAAGCCGGTCCGCGTTCTTGACGGGAAGATACCCCATCCGATC
AG
gtgcgcaaactggcgggctctgctgggctctgccctcatgttaggatgtgaggaaacaaa
aatgtggcttgaccacgttaacaagtaaaaaagggctgggcacgatggctcacgcctgta
atcccagaacttcgggaggccaaggtgggaggattgcttgagcccaggagtttcaaacca
EXON 5  123 bp
tgtaagggcactgattccattcttgaggctccaccctcctgacctcatcccctcctaaaa
gccctacctcctaaccattaccttgcagatgaggatttcaatgtgcaaattttgtagtga
caaaaatattccctctgtagcaacacctactcattgtacttttttccacactacatctag
GTATGGTTTCTAGTGGTAATAGACGTGTCATCCAAAATCTTGCAGTCCCCGCAGGCCTCC
CTCTTAATGAGACAACACTTGCAGCCTTGCTAAAGAAGCAAGGATACAGCACGGGGCTTA
TAG
gtaagacacaagaattggtgttagtcattgatcataaggtaatcatgtcctttgttctac
ccttgatttatgactttcttggaaacgctgtattttacaatgtcttatgtaaaggcgcag
tggcccatgcctacaatcccagtactttgggaggccaaggtgggaggatcgctggaaacc
EXON 6  424 bp
gaacaaaaaaaatgtggctaagtggcactcggattttttagaggaaggagaatatctctg
ctactttatttttgtgtattagctgattgtttcacgtgaagaatgctcacatggtttttg
caatgtgctggcatatgttgacatattgatgcgtagatgtgtttgtgtgtttggttttag
GCAAATGGCACCAAGGCTTGAACTGCGACTCCCGAAGTGACCAGTGCCACCATCCATATA
ATTATGGGTTTGACTACTACTATGGCATGCCGTTCACTCTCGTTGACAGCTGCTGGCCGG
ACCCCTCTCGTAACACGGAATTAGCCTTTGAGAGTCAGCTCTGGCTCTGTGTGCAGCTAG
TTGCCATTGCCATCCTCACCCTAACCTTTGGGAAGCTGAGCGGCTGGGTCTCTGTTCCCT
GGCTCCTGATCTTCTCCATGATTCTGTTTATTTTCCTCTTGGGCTATGCTTGGTTCTCCA
GCCACACGTCCCCTTTATACTGGGACTGCCTCCTCATGCGGGGGCACGAGATCACGGAGC
AGCCCATGAAGGCTGAACGAGCTGGATCCATTATGGTGAAGGAAGCGATTTCCTTTTTAG
AAAG
gtaagcggaataattacaaattcatgtaataatgataatgatctcttttttaaaaggacc
tagatagatctgtagggtgattgtagtttataataatctattgtacacttctaaatagct
aaaagagaataagtcaaatggctctagaataaagaaaagacaaatatttaaggtgatgga
EXON 7  137 bp
tgaggtgctgcaggatcatggagtccattctatgcaggatggggcccttgggtggaccca
ctctatcttctgcagcttggagaagaaggaagcaggtcatgtctatgagaagccaaaaca
atagttttcacattcatagatattgaaaactcacaagtagtttcattgatgtcttctcag
GCACAGTAAGGAAACTTTCCTTCTCTTTTTCTCCTTTCTTCACGTGCACACACCTCTCCC
CACCACGGACGATTTCACTGGCACCAGCAAGCATGGCTTGTATGGGGATAATGTGGAAGA
GATGGACTCCATGGTGG
gtaagtcacaggacttaagtggacagaaactaacgtgttctgataggacaggacacctga
aaactgctcttggtcaacctgtagagtgaagagaattatgcctatgggacagagtggtct
gagacattaatgaggtaatagttgctagcaattgagaaagtcagcaaaaaaactatatgc
EXON 8  135 bp
tttttctctttcaatggtttgtcaatttaaactgttaatgcacatttcttttcttttgtg
gcttttgacatagggtcacaccatccttgttttcctttagatagctcatgcccatttgac
ttaggggtgaaatacctcataatgtcattatttttacttgtctcttgtatattattttag
GCAAGATTCTTGATGCTATCGATGATTTTGGCCTAAGGAACAACACCCTTGTCTACTTTA
CATCAGATCACGGAGGGCATTTGGAAGCTAGGCGAGGGCATGCCCAACTTGGTGGATGGA
ATGGAATATACAAAG
gtgaggagaggaactcatgcaagtgatctggtggtgaataagcttttttgtggttcttat
aattaaagcccatgacacaaaggaatgaggcctgaaaaactgaacaagtttgtttaattt
gactcttagtaaaatgaagtattggaccaaggtcaagaaaattggtcttacatttgttaa
EXON 9  163 bp
cagcagcacaggaaaatataattctgtagacgtgcactacttaccccactaggactctac
atagagtagacactatacaaatgtgatctcttttgatactagcttaccttttaaatacat
tcaatacagtgactattttaactaggcacaataattgaacttaattgcattgtcttatag
GTGGAAAAGGCATGGGGGGCTGGGAAGGTGGAATCCGCGTCCCAGGAATTGTCCGATGGC
CTGGAAAGGTACCAGCTGGACGGTTGATTAAGGAACCTACAAGTTTAATGGATATTTTAC
CAACTGTCGCATCAGTGTCAGGAGGAAGTCTCCCTCAGGACAG
gtgatgtcatataaactgttaacaagagcttattttcacccttcttccttctcagaagat
tcagaacaaggagactgactctatcctggcagacccactttttccctagtatctacacag
ttttaccttcctatatgactgtgtctattcagcatttttcagaagagaccagtcttttct
EXON 10  125 bp
ttctcttgtccactggagtgtaatctcccagagagcatgcatgagttttcctaaagactc
agtacgctgtcctctggacctgaggcatgacgcagtcttcaccaagtacccttcaggtag
cttgggacccaacgtcccttctcctcattttccttatctgcactgtctgtgtctctgcag
GGTCATTGACGGCCGAGACCTCATGCCCTTGCTGCAGGGCAACGTCAGGCACTCGGAGCA
TGAATTTCTTTTCCACTACTGTGGCTCCTACCTGCACGCCGTGCGGTGGATCCCCAAGGA
CGACA
gtgagtgctcaacccgttgcttcctgttccctgccaggagcagggtcactcaggtgtatc
ctgaacgcattcttcctttcctctctagaccggtcctttcattccagggctcactgaaca
catggttttggagaagtttctcagaattgctcttctgcagaaaggcaggtgggggtaatg
EXON 11  533 bp
aagcttcgctctctcccccaaccactcacctcctgtgtgtgaccaggttcttaacaggcc
acgaacaggtaccagtttgtggcctggggactggggacccctgctatagaacactaggac
ttcttcctttgatctggctgaagtgcgcatcatttgacgagtctctcttttctcctccag
GTGGGTCAGTTTGGAAGGCTCACTATGTGACCCCGGTATTCCAGCCACCAGCTTCTGGTG
GCTGCTATGTCACCTCATTATGCAGATGTTTCGGAGAACAGGTTACCTACCACAACCCCC
CTCTGCTCTTCGATCTCTCCAGGGACCCCTCAGAGTCCACACCCCTGACACCTGCCACAG
AGCCCCTCCATGATTTTGTGATTAAAAAGGTGGCCAACGCCCTGAAGGAACACCAGGAAA
CCATCGTGCCTGTGACCTACCAACTCTCAGAACTGAATCAGGGCAGGACGTGGCTGAAGC
CTTGCTGTGGGGTGTTCCCATTTTGTCTGTGTGACAAGGAAGAGGAAGTCTCTCAGCCTC
GGGGTCCTAACGAGAAGAGATAATTACAATCAGGCTACCAGAGGAAGCCTTTGGTCCTAA
CGAGAAGAGATAATTACAATCAGGCTACCAAAGGAAGCACTAACTTTGGTGCTTTCAAGT
TGGCAAGGAGTGCATTTAATAGTCAATAAATTCATCTACCATTCCAGATTATT
aaaggcccactggttgttccacttgctgcttttttttggattcctgtggataaatgttga
ttgaaatttgttttatttcccgaaagcttataatttactaattctcttataaaaaatccg
cacgatggccgctgataatgtcactgcagaattgctacttcttctgtttgtcacccagtc