Gene ARHGAP4 Variant 1
DNA : 18.87 KbNT_025965
mRNA : 3235 bp NM_001666
CDS : 2841 bp NP_001657
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  109 bp
gccggggcacagtggggctggaaggggcgccctgcccccccaggagcccctcgcgggcag
tgccagccctgggccgccccgccccaccgggagccgcgctgggggcggggctgggcggag
cccgcgcagggtgctggccgcagcgcccccaagtcccggcgccgggcccgctcacggccg
CGTGGGAGCAGTGGGGTTCGACGGCGCGGCCGCGAGGCCGCCATGGCCGCTCACGGGAAG
CTGCGGCGGGAGCGGGGGCTGCAGGCTGAGTATGAGACGCAAGTCAAAG
gtgagagggcgccgggcgctcccggcccgtttcctgcggagaacccaaggtcgtgaggga
gctccaagcgtccccgcgctggcccagggcccgatgctctccccagcgacctctggagcg
ggggtggaggagggagcctgagccccttgcctgcctcccgacgcccatttggcctcaacc
EXON 2  205 bp
caggggcctagcttctttcctcccctcttagctcttgccctcagcctaggctgggtccga
aggagccctcagagccgacgggactggggtctgtgtgcctctgcctctcccatcccacgc
tggcctggctgacccaggcagggcgtgctgaccaggcctgagccatggttccccccacag
AGATGCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGAGCTGCAGGGCGAGCTGCGGC
GGGAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTGAGGTGGAGCTGGAAT
ACTCCCGGGGCCTGGAAAAGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCCTGGGGA
GCAGCCGGGAGCACCAAAGCTTCCG
gtaggtgatgtgctggcaggggggccacggcagggcccaagctccgctcccaggtctcag
tgcccctctacccccaggaaggagccgtccctcctgtcgcccttgcactgctgggcggtg
ctgctgcagcacacgcggcagcagagccgggagagcgcggccctgagtgaggtgctggcc
EXON 3  163 bp
ctgaggtggagctggaatactcccggggcctggaaaagctggccgagcgcttctccagcc
gtggaggccgcctggggagcagccgggagcaccaaagcttccggtaggtgatgtgctggc
aggggggccacggcagggcccaagctccgctcccaggtctcagtgcccctctacccccag
GAAGGAGCCGTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCTGCTGCAGCACACGCG
GCAGCAGAGCCGGGAGAGCGCGGCCCTGAGTGAGGTGCTGGCCGGGCCCCTGGCCCAGCG
CCTGAGTCACATTGCAGAGGACGTGGGGCGCCTGGTCAAGAAG
gtgaggctctcatcctgggccacgggaagtgttcgaggctttgggatcaggaggcactgt
ggctgggagggcactggaggccaggtggggagcaggcagagcgaacctgtgtgccccccc
gatggggcttgatctgggcagagcttccagtgcctggcggggccgctctgggcagtgccg
EXON 4  63 bp
gaagtgttcgaggctttgggatcaggaggcactgtggctgggagggcactggaggccagg
tggggagcaggcagagcgaacctgtgtgcccccccgatggggcttgatctgggcagagct
tccagtgcctggcggggccgctctgggcagtgccgtgctcacccttgcctctgcctctag
AGCAGGGATCTGGAGCAGCAGCTGCAGGATGAGCTCCTGGAGGTGGTCTCAGAGCTCCAG
ACG
gtgaggaaagggctggggaggggcctgccccaatggtccagggagaaatgccactcacag
tggggaggaacaccgccagaccatcacatcaccccaagccaggctcagggagaagcacgc
acctaggggcaaaggcctctctccctaggcacagggcgttaggctaagtgctcacatggg
EXON 5  183 bp
gggagaagcacgcacctaggggcaaaggcctctctccctaggcacagggcgttaggctaa
gtgctcacatgggatcgcccagctctgaggtccaagttccagaggggcaggggtagaggg
ctgggggctggcccagccgtggccttcaccagcaccaccttgctttgggtctccctgcag
GCCAAGAAGACGTACCAGGCATATCACATGGAGAGCGTGAATGCCGAGGCCAAGCTCCGG
GAGGCCGAGCGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGT
GCCACTGAGGCAGGGCCCCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGCTGGTGGAG
AAG
gtgggcctggagggcacctcagacgcaggcctatgggccatgggccctaactaggacctg
ctgtgctgagggggaagtcagggctgggtgcaggggagggcaggagtggcaggacagtgc
catcaggttccagggattccatacggaaggctcccagggcctgagagagtggggaaaaca
EXON 6  129 bp
tggcactgggctgagcacactgtggactgtggcgtggggaaggcagcaggacttctgggc
ttgaccagttcaggtgtagttgtccacagtgggaggggaggcgatgggcattacatgaaa
ggctagagataggggctggccacgtgcgtgaccctggcacgcttgcattgtcttgagtag
CGGCAGGCCAAGTTCATGGAGCACAAACTCAAGTGCACAAAGGCGCGCAACGAGTACCTG
CTTAGCCTGGCTAGTGTCAACGCTGCTGTCAGTAACTACTACCTGCATGACGTCTTGGAC
CTCATGGAC
gtgagtccttggtgggcaggtgggaaaaggtgcctggtgcctcggggctgggaagctgtg
gctccaggacctacccaagcatctccttgtttcctcctcagtgctgtgacacagggttcc
acctggccctggggcaggtgctccggagctacacggccgctgagagccgcacccaagcct
EXON 7  222 bp
cgagtacctgcttagcctggctagtgtcaacgctgctgtcagtaactactacctgcatga
cgtcttggacctcatggacgtgagtccttggtgggcaggtgggaaaaggtgcctggtgcc
tcggggctgggaagctgtggctccaggacctacccaagcatctccttgtttcctcctcag
TGCTGTGACACAGGGTTCCACCTGGCCCTGGGGCAGGTGCTCCGGAGCTACACGGCCGCT
GAGAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTGTGGAG
GCCCTGGATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTGT
CCCCCGCTGCGCTTTGACTACCACCCCCATGATGGGGATGAG
gtgagggtcaccccctgctgggcttggcattctctggccttcactgtaatggtgggcagt
ggagtggcatgacccacactttgctcaggaatccaagttctccatggtctcaggcagtgc
ggcagctagagaagtgtcccacttccatttgcagcctcactccaagggtgcacccccgca
EXON 8  102 bp
acaagtcttggtttggacacgtgtgttcactcctgccattcttcagctgagcgtctgggc
tggtggtcctgtgcccggccgccaggccacaaaagggtgcttgcttcccttatgccccgg
ggatcttggcacctactgcccaagcccagcccttagccccctggccgccgccctctgcag
GTGGCTGAGATCTGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAAC
ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAG
gtctgggcagcccaccgggggttagagggagacgagggcctggagcctgtacagcctgct
gttggaagtggctgccctgcctgcccccctccctttggccccttccttctgacttggact
tcctgtctccctccctgtcccccacctcttaccaccctggtgtggtctcctctgcaggtg
EXON 9  192 bp
gaggtctgggcagcccaccgggggttagagggagacgagggcctggagcctgtacagcct
gctgttggaagtggctgccctgcctgcccccctccctttggccccttccttctgacttgg
acttcctgtctccctccctgtcccccacctcttaccaccctggtgtggtctcctctgcag
GTGAACAAGACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGTGGTGGCCTCGGATGAC
GGGGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGC
TCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACC
TTCTACCTCACG
gtggggagggctgggctggtgggcgggacccgtgggggcattgctggggcagagggaggg
gctcaagccagggctaacacttggggctcttcttggggctgcccagaagctccaggagta
tctgagtggacggagcatcctcgccaagctgcaggccaagcacgagaagctgcaggaggc
EXON 10  85 bp
gctcagacccaggcagccggcaggcgggccggaggcgcggccagcagcaggagaccgaaa
ccttctacctcacggtggggagggctgggctggtgggcgggacccgtgggggcattgctg
gggcagagggaggggctcaagccagggctaacacttggggctcttcttggggctgcccag
AAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAG
AAGCTGCAGGAGGCCCTTCAGCGAG
gtgggcccagtgctgcccccttccccgcctctcccctgcccaggaccctgtctagcccac
ggtcctcccctcccgcctgtccttggctcttatccacacctttctctctgggatgccttg
aagacccctggcccgagaggcagaccaatgttctcccaccccacaggtgacaaggaggag
EXON 11  28 bp
ggcccttcagcgaggtgggcccagtgctgcccccttccccgcctctcccctgcccaggac
cctgtctagcccacggtcctcccctcccgcctgtccttggctcttatccacacctttctc
tctgggatgccttgaagacccctggcccgagaggcagaccaatgttctcccaccccacag
GTGACAAGGAGGAGCAGGAGGTGTCTTG
gtgagtcctccctgagggctggggccctgcgacggtccgccatctcttctcttcctgggg
cccagctcagctgcccaatcccctgggcctcacttccccagttttcgcactggattgtgg
aataacttcagagaattagaggccggcttggctggcctggggggtggggcaccctattct
EXON 12  103 bp
atctcttctcttcctggggcccagctcagctgcccaatcccctgggcctcacttccccag
ttttcgcactggattgtggaataacttcagagaattagaggccggcttggctggcctggg
gggtggggcaccctattctccacacctggccccctcagagccagctcccattcactgcag
GACCCAGTACACACAGAGAAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTCCCAGTA
TAACCAGAGACTCTTTGGGGGAGACATGGAGAAGTTTATCCAG
gtactagctttgccccacatgccagcccacctgtacatgctgatctttcttcagctctgg
gtcacctcagtggccggagcagctgcctgatcccagggtcctccactctcaatcagtcat
caactgtccttttctgggtgggcctcttccaggccactgttgggctcccctatagcctcc
EXON 13  61 bp
aggagtatcacttgagcccaggaagctgaggctacagtgagccgagatcacgccagtgca
cttcagcctgggtgacagagtgagaccttgtctcaaaaaaaaaaaaaaaaaaaaaaagca
attgaatgacaacacagggcatgctgtgtccatggtgaagtaaacaccctctgtccccag
AGCTCAGGCCAGCCTGTGCCCCTGGTGGTGGAGAGCTGCATTCGCTTCATCAACCTCAAT
G
gtaagcaggacccagcccctcccgatgtcctggcacccagcacccagttcccagcacctg
gcatgggaggccatcctggaggggctggggaagatgctcagtgcccaccagctccttgtc
ctcccacaggcctgcagcatgaaggcatcttccgggtatcgggtgcccagctccgggtct
EXON 14  78 bp
agcctgtgcccctggtggtggagagctgcattcgcttcatcaacctcaatggtaagcagg
acccagcccctcccgatgtcctggcacccagcacccagttcccagcacctggcatgggag
gccatcctggaggggctggggaagatgctcagtgcccaccagctccttgtcctcccacag
GCCTGCAGCATGAAGGCATCTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGAGATCC
GTGATGCCTTCGAGAGAG
gtggggacgggcagggcgggcgggggtgggggctcgggcagatgtcaccagcttcctccc
cctaccgcaccactcgcccatctgcaggggaggacccactggtggagggctgcactgccc
atgacctggactcggtggccggggtgctgaagctctacttccggagcctggagcccccac
EXON 15  135 bp
cttgtcctcccacaggcctgcagcatgaaggcatcttccgggtatcgggtgcccagctcc
gggtctcagagatccgtgatgccttcgagagaggtggggacgggcagggcgggcgggggt
gggggctcgggcagatgtcaccagcttcctccccctaccgcaccactcgcccatctgcag
GGGAGGACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGTGGCCGGGGTGC
TGAAGCTCTACTTCCGGAGCCTGGAGCCCCCACTCTTCCCCCCAGACCTGTTCGGCGAGC
TGCTGGCTTCTTCGG
gtgaggctggggcctgaggctggcggggtagggcacttgctggggcagccccgctcacgc
ggctctctctgggcggctttggccacagagctggaggccacagcggagagggtggagcac
gtgagccgcctgctgtggcggctgcccgcgccggtgctggtggttctgcgctacctcttc
EXON 16  106 bp
ctcggtggccggggtgctgaagctctacttccggagcctggagcccccactcttcccccc
agacctgttcggcgagctgctggcttcttcgggtgaggctggggcctgaggctggcgggg
tagggcacttgctggggcagccccgctcacgcggctctctctgggcggctttggccacag
AGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGTGGCGGCTGCCCG
CGCCGGTGCTGGTGGTTCTGCGCTACCTCTTCACCTTCCTCAACCA
gtgagtgctgcggggcgagtgctggggtgggggccaggggtcgaggggacagggggactc
ggggtgcgggctctctgcttgtgatgtgcgtgtccccccagcctggcccagtacagcgat
gagaacatgatggacccctacaacctggccgtgtgcttcgggcccacgctgctaccggtg
EXON 17  234 bp
agcacgtgagccgcctgctgtggcggctgcccgcgccggtgctggtggttctgcgctacc
tcttcaccttcctcaaccagtgagtgctgcggggcgagtgctggggtgggggccaggggt
cgaggggacagggggactcggggtgcgggctctctgcttgtgatgtgcgtgtccccccag
CCTGGCCCAGTACAGCGATGAGAACATGATGGACCCCTACAACCTGGCCGTGTGCTTCGG
GCCCACGCTGCTACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAA
CCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCCCCTGACCTCGCT
GCCTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGG
gtacacccttggtgctgccgaggggactggggggtccactggagaagagcccccctcatc
tgcctcgctctgccctgaacctcagggacgcccagctggagagcctgggggcggacaatg
agccggagctggaagccgagatgcccgcacaggaggatggtgagggcgatgggcagagag
EXON 18  74 bp
atagtgcagcccgatcgggtcttcccgcccctgacctcgctgcctggccccgtctacgag
aagtgcatggcaccgccttccgccagctgcctggggtacacccttggtgctgccgagggg
actggggggtccactggagaagagcccccctcatctgcctcgctctgccctgaacctcag
GGACGCCCAGCTGGAGAGCCTGGGGGCGGACAATGAGCCGGAGCTGGAAGCCGAGATGCC
CGCACAGGAGGATG
gtgagggcgatgggcagagagccccaccctgtccccaccctagtgtccacaccccctccc
acagcttggaccccctctcctccccagacctggagggggtcgtggaggctgtggcctgct
ttgcctacacgggccgcacagcccaggagctgagcttccggcggggggacgtactgcggc
EXON 19  184 bp
gctctgccctgaacctcagggacgcccagctggagagcctgggggcggacaatgagccgg
agctggaagccgagatgcccgcacaggaggatggtgagggcgatgggcagagagccccac
cctgtccccaccctagtgtccacaccccctcccacagcttggaccccctctcctccccag
ACCTGGAGGGGGTCGTGGAGGCTGTGGCCTGCTTTGCCTACACGGGCCGCACAGCCCAGG
AGCTGAGCTTCCGGCGGGGGGACGTACTGCGGCTGCACGAGAGGGCCTCGAGCGACTGGT
GGCGGGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCCCG
CCGG
gtgagtgagccgcgccctcaggccccagggctcccggagtctccccttcatccacccctc
ccccgaccccaagttagattctgaaggtctgggctgggccagagaacagagcctctctga
ccactcctggctggcgcggagctgctggccctggaccccgtgcagggaaggagcactcga
EXON 20  93 bp
cagggctcccggagtctccccttcatccacccctcccccgaccccaagttagattctgaa
ggtctgggctgggccagagaacagagcctctctgaccactcctggctggcgcggagctgc
tggccctggaccccgtgcagggaaggagcactcgaaacaggccggtccttcccaccgcag
GACGGAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTCTGGGAGCAGTCC
CGAGGGCCTCCTGGCATCGGAGCTGGTCCACCG
gtgagcaagaagacggggctcagggggccacacgtgtgctgttctaggccagaggggact
ggggtcaggctttggccagtgggagtgggaggagttggcagatgaggacgtgacagaatg
acccagcttgtgacagggagaggctctagaggagcttggggaccactgggccagcctcct
EXON 21  100 bp
gttggcagatgaggacgtgacagaatgacccagcttgtgacagggagaggctctagagga
gcttggggaccactgggccagcctcctttccttggccacaccccaggatgggaggagcca
ctgcccagctagctcagggacttcccagggcccccaccaggctccctgtctgtcctgcag
GCCAGAGCCATGCACCTCACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTT
GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAG
gtgagagtgggtgtgtggcaggtgagggacatctgtcctgggggatctctgcctcccctt
ggaagccaaactcctccctcctcgaggttccagtcgttgccctccctggccttagctcaa
gggaacctgccgccagacacacaggcccaaggcagagcctgtggagggcaggaaggcaaa
EXON 22  586 bp
gacaccaacagggacaggagggatgccaggtgcaaagtgggggagagtgacctggaggct
gagggactggggatgttggctgagggcttgctttgggagtgggaggaactcaggtgggtc
ttgggcagggtcagtcgggggaactcactggtcactctccctttctttcccctccgctag
GCTGTGGCACAGAACATGGACTCTGTGTTTAAGGAGCTCTTGGGAAAGACCTCTGTCCGC
CAGGGCCTTGGGCCAGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCC
CCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCGGGGCCCTGGGGCCCCAGCC
TCACCCTCAGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCC
GCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCCCC
CTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGA
GAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGCTCCACATCCTGCCTGCCCCTCAGC
CCTGGCCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGCTGGGGAAAGCCCTCTTCTG
CAGCTTTGTGGAAGGCTGATCAGTGGCTGCTGGGTGGCGGGTACCCTTGCTCAGATGCCT
GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCG
atgggagccagctctctgtctcgggtgggcaggtgggtgctggaggtgagaacagcttcc
ccaggggtcctgcagctttgaagacttggctgcctgcgccatggattccagagctgtgca
cgtgactgtgggtgtgtgtggggagtctgtgtatgtctctgtgctgcctccacacccacc