Gene AMOT Variant 1
DNA : 66.31 KbNT_025319
mRNA : 6888 bp NM_133265
CDS : 2028 bp NP_573572
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  364 bp
gctcccctcactcctcacttccagggtccaggcaggctcccgcccttctttccccgccct
ctactccgccttcctccctcgtccacccctcccgccgccctgctccggggcggtcctagc
cgctcaccgcaagaagaaaagccacccgttcgtccccctcccctacctcccatcctttgc
CCAGGAGCTGCCTTGGCAGTCACGCCCCTTCCTTCCGAGGAGCTTTCTGGCTGCCTAAAC
TGGTAGACCCCCTGAATTACTCCTCCATCTCCGCTCTCTTTCGCCTCCTCTTCTCTTAGT
TCTCTCCGCCTCCCCCTCAACTACCACCACCTCCAGTCAGTCTCGCCTCCGGCTATCCGC
TGCTCCACCCTCTGGCCCGGTATCCTGCCTGTCCGCTGCCACCAAGGAGAGCCCGGACGG
AGCAGCGAGGAGGGGAGCAGCCGGGAGTTGGGGCTTCCCCCCTGCCCATCCCTGGCCGCT
GGCCCGGGACCGAAGCCACTTGAGCGAGCAGAGAGTCGTCACCTTGTCTTCTTTGCCTTC
AGGG
gtaggagacgcgtggttacttttcgcggggaactggggcaggaatccatggtggcatgaa
cttggtcgtgccctcggcgtgagtgaatcgatctaggcgcgtgtgggaatgcccgtgtgt
tctactttctttgcagctcgccatgagtttttttggatgtgcagcaagttaaatcggtta
EXON 2  77 bp
tgtcttagaaccaagcacagggcaggaagtcgcaagacctgggttccaatgctggcccta
ccaatgggcaacagtgaaattctggtccaattagttatgattagctatctgttctggact
tgagcttccctctccagttctaaaatggaattaatcacatctgcctttatttccccacag
AGCTGCTAAGAAGGACAAATAAGATAGCAGAGTGAAAGAGCTTTTGTCTCCTTAGAAGGA
AGGCTGAGAAACTAAAG
gtaataataacattattattattgttattccatgtctttctttgttttcttctcctgctg
tggcctctagcaaagttttggggaagttatcattcactcagtatgcaactattaagcaca
ttttatgtaccagttaatgttttaggtattgggatgcatacaatgaaaaatcacgcaccc
EXON 3  520 bp
gtggtctttgcagagatagagcaggcagggttagacttccccatagtcagaccctgcctg
ctcttcattttgcaggtgtcctgggggcatcagaagcctcctcatctcacttttgtgtgc
ccttctcccccagtgccttaggagagaaattaacccgcacctgcccttcatgttttacag
GCCAGCGCAGGACATCTCATTGCCATTGTCAGCCAGGAACTCGCAGCCTCACAGCCCTAC
TTCTTCTCTGACCTCTGGGGGGTCCTTGCCCTTGCTACAATCTCCACCATCCACTAGATT
GTCTCCTGCCCGACACCCCTTGGTCCCAAACCAGGGAGACCATTCAGCTCACCTGCCTAG
GCCGCAGCAGCATTTCCTTCCTAATCAGGCTCACCAGGGGGATCATTACCGTCTCTCCCA
ACCTGGCCTGAGTCAGCAGCAGCAGCAACAGCAGCAGCAGCACCATCATCACCATCACCA
CCAACAACAGCAGCAGCAGCAGCCACAGCAGCAGCCAGGAGAAGCCTATTCAGCTATGCC
TCGGGCTCAGCCATCCTCTGCTTCTTATCAGCCAGTGCCAGCAGACCCTTTTGCCATTGT
TTCCAGAGCCCAGCAGATGGTTGAGATCCTCTCAGACGAGAACCGGAACTTGAGGCAAGA
GTTGGAAGGATGCTATGAGAAGGTGGCAAGACTGCAGAAG
gtgaggcttccgttttgggatattagggtctctaagtctttatttgtgagacttgtttaa
tatccacattaaagtctccagttgtgaatcccagcattacttgtggcaggtcttcaggat
ttttatatctgaaggttagatatgagtcaaactttggaaaaagccttctacctgtctacc
EXON 4  145 bp
ttatggttgaaggtggagatcctttcttgaaacttgtgtcatctgactgtgttatgcttg
cctcctggccatctgtgagccctgggagaagctgtcagcgaggatttgcctgtttgtttt
cagaccattttccccatcaccctcctaccatcaccaccattgtctttttttgttgttaag
GTGGAGACAGAAATCCAGCGCGTCTCGGAGGCATATGAGAACCTCGTGAAGTCATCCTCC
AAAAGAGAGGCCCTAGAGAAAGCCATGAGAAACAAGCTAGAGGGCGAGATTCGGAGGATG
CATGATTTCAACAGGGATCTGAGAG
gtgagggaaccaacagacttgtctttgtacttctgaagcagctgcagggtggtgaaggga
agggctgagcaggatccaactaggctctttggggttgtccaacccaccggtatgggcagt
aaatggctgggcatgtgccaggctaattttttgtgactgcaatagtcctcagtcccaagc
EXON 5  93 bp
tccccggccatggtctagtattattttgggattcacatttgcaaactcatgttagtcacc
cattcctgtttaacaagaagaaacaggcttgttttaccaaaggtcagtatttagagggcc
aatagtatgtgcatgaaagtttacatttgagaccctgttgattgtctccaaatttcacag
AGCGTCTAGAGACTGCCAACAAGCAGCTTGCAGAGAAGGAATATGAGGGGTCAGAGGACA
CCAGAAAAACCATCTCGCAGCTCTTTGCAAAAA
gtaagtctgcaagctgcagaaacaggtattaacgtgtggatgggagcaaggtgcgtgaaa
agattacactgttctctttagccttttagaacagccagggcagagtcaatatcacctaag
gattgtttttcctattcaggcatgaagttggaagattctgttcttttcctcctaagccaa
EXON 6  146 bp
atttctacaacaagttagtgagagagccagtgatagagtccagatcttgggtatactggt
tcttcagctgtgcactagagcagtaggctatctagtaaagggtatgatgtgtcaattttg
ctcaggtaaggctttgagctagctccaggctggcagtgttgatgtttaatgtcctgacag
ATAAAGAAAGCCAGCGTGAGAAGGAGAAGCTGGAAGCGGAGCTGGCCACTGCCCGTTCTA
CCAATGAGGACCAAAGACGACACATCGAAATCCGAGATCAGGCCCTGAGTAATGCCCAGG
CCAAGGTGGTAAAGCTGGAAGAAGAG
gtatggtttcctcaggtagcatatgagcctgggggtgggagggctgggaaatcggggaca
ctgggctccacattgtggtgaattggcagctgcataatccccagaagggaggtgccatct
gctgctcctagtttccactgtgctgatgtgagtggactttgctttcttttctcttcttgg
EXON 7  150 bp
caatacaaggcagcctgctactcattgtgaaggaccttctcgccatccattcctttttgc
agctggactctaaaacaagaagagatctaaacacaaggctggatttaggggatacataat
tgaccctgttgcttgctgtttttcctttcaccttgcaaattacccaacatggatttccag
CTGAAAAAGAAGCAAGTGTACGTTGACAAGGTGGAGAAGATGCAGCAGGCCCTTGTACAG
CTCCAGGCAGCATGTGAAAAACGTGAGCAGCTAGAGCACCGTCTCCGGACACGACTGGAG
AGGGAACTGGAATCCCTGAGAATCCAGCAG
gtatggagaacttaaaggaagaaagggaaaaaaaagtaagaaaatgacattattcctggt
tgcttatttttcagttagcatttgacatgaacactgaaagcacacacttgctcattttta
catttttctcccacctaatcttactccagagtgcctcccaattgtgaatacaaagtctgt
EXON 8  191 bp
attcaagcccatgataggaagtcctgtggccctgggaggagatctgaattccccctgctt
ctttctgaatcagagtcgaaacagaagtaggctgggcagtaatcctctccaagaataggg
gctcagacaccatggttcttctctcactaacttgagggttctctgcatctgccccaacag
CGTCAGGGCAACTGTCAGCCCACCAACGTTTCAGAATACAATGCTGCTGCACTGATGGAG
CTCCTTCGGGAGAAAGAGGAGAGGATTCTGGCTCTGGAAGCTGATATGACAAAGTGGGAG
CAGAAATATTTGGAGGAGAATGTGATGAGACATTTTGCTCTGGATGCTGCTGCAACTGTG
GCTGCTCAGAG
gtaagtaggtagctggtagggcatgagtgggaagaacagaaaggtcactgattcatagat
ttttccagtgttttattttctttaatattctgggtttcccccccaatttctgcctaagtg
tgttttctttcatctgattatgcagggaatgaacggctgtagagacagagggtcagggat
EXON 9  123 bp
gaacgctgaactgtcctattttggaggctcttacgggttagttccccagaaaccatctgt
tccaaatgtgcttgatttcagcttaggactttccagaaaagccttccttgacttagaaga
aagataacattcattgatcttgctatgctcccatctcatcacttccattttcctccccag
GGACACAACAGTCATCAGTCACTCTCCTAACACCAGCTATGACACAGCTCTAGAAGCTCG
CATCCAGAAAGAGGAGGAAGAAATCTTGATGGCCAATAAGCGTTGCCTTGACATGGAGGG
CAG
gtaaaatgttgttctggaccctgaggaatctgagacattgatatagagaccacataggat
ctttattcacagctaggaaatctgatcatgcagcctccccgctccaccatcacccctgcc
agcctgtcacttaaaggtgtgagatgcaatgacctttaccttgataatctccactaaaca
EXON 10  233 bp
ccagctaatttttgtgtttttagtagagacagggtttcaccatgttggccaggctggtct
cgaactcctgactttgcaatccgcccacctcggcctcccaaaatgctgggattacaggcg
taagccaccgcgcccagcccacaacaaggtctttatatgttctttgcctttggctcctag
GATTAAGACCCTCCATGCCCAGATTATTGAGAAGGATGCCATGATCAAAGTACTCCAGCA
GCGTTCCCGGAAGGAGCCGAGCAAGACAGAGCAGCTGTCGTGCATGCGGCCAGCGAAGTC
TCTGATGTCCATTTCCAATGCTGGATCAGGCTTGCTCTCCCACTCATCCACCCTGACTGG
CTCCCCCATCATGGAAGAAAAGCGAGACGACAAGAGCTGGAAGGGGAGCCTAG
gtaatgacagtaaataaggaagattatagtcacgtgttcaaagagagccctgagataagc
acccatgcttaaggaaaagggatgatggtccaggttctagagaggaaggtgtaccagggt
tttggagtttttttttcctcctgagaccctagttccacattctggagctcctccacactt
EXON 11  684 bp
cttagactattctaaattatttaatatttaaaaataataatattttaaatatttaaataa
tatttacttatttaaaaataaataaatttcttctgaaatttgaatgggagaacaggtaat
tagatgtctggatttgaatcacctattgttttctaacatctgttcctctttcatttgtag
GCATTCTCCTGGGTGGAGACTACCGTGCTGAATATGTCCCTTCCACACCCTCGCCTGTGC
CACCCTCGACTCCCCTGCTCTCGGCTCACTCCAAGACAGGCAGCCGAGACTGCAGTACCC
AAACTGAACGTGGGACGGAATCGAACAAAACTGCAGCTGTTGCTCCCATCTCTGTTCCTG
CTCCAGTTGCTGCTGCCGCCACTGCTGCCGCCATCACTGCCACTGCTGCCACCATCACCA
CCACCATGGTAGCTGCTGCTCCAGTTGCTGTTGCTGCTGCTGCTGCTCCAGCTGCTGCTG
CTGCCCCGTCTCCAGCCACTGCCGCTGCTACTGCTGCTGCTGTTTCTCCAGCTGCTGCTG
GTCAGATTCCAGCTGCTGCCTCTGTTGCCTCAGCTGCTGCCGTTGCTCCTTCTGCTGCTG
CTGCTGCTGCTGTTCAGGTTGCTCCAGCTGCTCCGGCTCCAGTTCCAGCTCCGGCTCTGG
TTCCGGTTCCAGCTCCAGCAGCGGCTCAGGCTTCTGCTCCTGCTCAGACTCAGGCACCAA
CTTCAGCTCCGGCTGTGGCTCCAACTCCAGCTCCAACTCCAACTCCAGCTGTGGCTCAGG
CTGAGGTTCCTGCAAGTCCAGCTACCGGTCCTGGACCACATCGTTTGTCTATACCAAGTT
TGACCTGCAATCCAGACAAAACAG
gtaattattccctttagcaggtaggttttggtttagttctgctctcaaatacagatttat
ttcttgttgtctgatgtctgggcagagttatcatttggactgagtttttcacgttctaaa
ggagagagaagagagtctgtaaatgacttctcatccaccaagatgggaacaggcatgagt
EXON 12  4162 bp
atccaccaagatgggaacaggcatgagtagaggccattatcttagcagaagtaaatgagg
gaggtggcaggcaagtctcactttgccattggcttcatgagggctctgatggtgtctggt
tctagaaatatgggttttttcttcatccctaagtgttttctaacccttatttccatttag
ATGGGCCTGTGTTCCACTCCAATACTCTGGAAAGAAAAACTCCCATTCAGATCCTGGGAC
AAGAGCCTGATGCAGAGATGGTGGAATATCTCATCTAAACGGCCAAATCAAGAGCTGCAG
ATTATCAGCAAAAATGCTTTTAATCATTTTCCCCCTTTTATTGGTTCTTGTTTTGAGGGT
GAGGACAAGGGTTGTGGGGAGGGGATGTTTTTTAACAGGACTTTTTATTGGAACAATGTA
CTACTTGAGTAATACCATGTGAACACCAGTCTATTTTGGTATGCTTAGGGAGTACCTCTA
AAGACAGATTAATCAGAATGTGCTCTAAAGCTTATTGTTTGAATTTATACGAATACTGGG
ACTGTTAACAGGTGGCTATACATCGACGTTTTCAATGTGCTTAAATTTGTTTAAATTTTC
CATATTCTAGATCATTTTTTATTGAAGAGCACAGTATGTGTGGAAGACAGTGTATAACAC
GTAGTTTGGAAGTGGGAAGCTAGAGAGAATTGAGTGTGTGCTGTTTTGTATAGTTACTAT
CCTGTGCAGCAGCTGGAGAAAGCACTCACCTCAGGCTTACAAAAGGGAATAGTTTCAGGA
GCTATGTAAGCTGGAAAAAAGGTAGGGAGTTTTGGGGTGCAGAAGGGTACTGGAGCTAAT
TTTTTCTTCCAGTTTCCCAGCTACCCTGCCCCAGGGAATTGTGTTTGTCTTCATTTCAGT
GGTGCTTTGGAAATGGATTCTTTTGGTTCCCTCCTGGAGGTTCATACATTCATATATATG
CTCTGGAGTAATTTATGCATTTGGATAATTAATATATTGCTTTCAGATGCTGGGAGAGTA
CATTAACTGAGTGATGCGCAACTTCCTCTCTCTTAGGGAATTAGACCATCAGAGGCCTTG
ATGGAGAGTTGCATGGGGTGCTATATGCAGACTTCCATGGTTTGTGTGTAGCCATGAACA
CAGCTTGCTTGCATTTAGTAAGACCAATCAGCTTAGTGTTTATTTCTTCTACAGCACAGA
TTCACTGGCTGGGTCTCCAGTCTCAAATTGCCAATCATTTGCAAAGTGAGGAAGGATCTT
TGTTGACAGGTTGAATGCTTTGAATTTCTGGTGACTACTTTGAAATAACTTGTTTTGTTT
GTCAAATTCTAAGCATATGTCTTAAAAGGCATTTTTGACTATCACCTCCAAGGGAATAGC
TTGAGAAACCCAAAGTACTATGCTGCAGTCGGGGGAGAGGTGGATTGCAGCAGTATCCTC
AACTACCTCTTCTCACTGTCAGTGACACCATCTTGGAATACCTTTGGGAAGCAGCAGGAA
ATGTGCATGTGGGTAGAGATCAAAGGAGGCAATGGCTCCAAGCCTTGCCATAGGGCTGCC
TCCAAGGACACAGAAGGATGCCAGTTGCCACAGGTCCCTGCCCTGTGTCACCTGTCTGCC
CTTCATTAAGGTGAGAAATCTGCAGATAGCATCATTAAGATCAGTTTTAAGGGGTATAGG
GAGGGTGAGGGAAGTGGGGGGTGTTAGGTAAGGGTTGGGGGTAGAGGTTTTGGGATGTCT
TAGTTAGAAACCAGATTAATAGAAGAGTAGGCCTGATATATTACATCATGAGCCATAGTG
GTGGGAAAGAACTTTAGCAATATAGCCCTACCTCCTCATTTTAGTGATGAGGAATCTGAG
AACTGGAGAGGTTCAGTGACTTTTTGAAAGTCATACAACACAGCTAACCATTATGCCAAT
CACCATGCTTATTTTGGGAAACTCTTTATCTTTTTTAAATTCCATTTTATGAAAAGGCAT
CTTCATGGTCCAGGGAATATGTATCTTGTAAAATGTACCTGGTTGGAGTAGCTTGTCCAG
TCTTGACAAACTACTGAATTTCTGTCTTGCCTCTCCTTCAGTGCCTTTTAAAAGGTTTTC
CCTTTTCTGATCTGCATTTCAACATAGAGTCACATAAATGTCCCCCTGAGAAACCAATCC
CACTTCTTTCTAGGAGATTGGGTATCTTAGATAATCTTTTGGGGTTCCTCTGTGAGTATA
GGAATGGTATCCTTCCTAATTATCTTCCAAAGGAATTATTTTGTGTGTGTGCCTGTGTGT
GTGTAGAGACATAAAGGAGGGTGATGTGATTTTCAGCTAGTCCTTTCACATTTTCAATAA
TGAGGTAATCATGTTACATACACATTAGTCCTCAGTTATAAAGTGAATCTCAGATAGAAA
TTAAAAGTGCAGTTGTGTTAAGACTCTTTCATACTACCCTTTAGTCATAAGGAGAAAAAA
ACACTCAAATAGTAGAAGCAGCAAGTAGCAAACTTCAGGAGAGCTACTTTCTATCCAAAT
AATTTAAAAAACACTTTTCACCTACTCCTTTCATGGTTATAACACATTGGCAGACTTTTT
GCTGGCTCTGGGAGCCATGATTTTAATCACATTCTGCAAGGTGACAAATGTCATACATTC
CACATTGTGTGGTAGCCATCTCTTTAGACTCATGTGTTTTGGGGAAAGGAAGAAGTTCTT
GGCTGAGTACTATTTTGAACTTTCCAGAACCCTCTCACACCAGAGACAGTTCTTCTCTGT
TCAGTTTCCAATCCCCGATAATTTGCTAAAATAACATTGTACATCCAAGAGAGGGAAGAA
GAGTATGTCAGTATATTATGCAGAAGATAGATACAGCCTTTTCAGAAGATCTCCACTAGT
TTTTGTTCCAAAAATTCAAGTTTATGGGAGAAATCTCAATTAGCCACCTTTTCACAGTTG
TGTGGATATAACATTTGGGGGATCTTTCTGGACTCCTACCTATCTGTGCATTTTACCGGC
ACCTCAGGAAAGGAGGGTGACCAGGTTGTCTTAGCTTGTACTGCTTGGTGATCTCTGAGG
ACCTTCTAATTCAGTTGTACCCCAGTGTTCCATGTATAGAAAAACTTCATTAGAACAAAC
TTTACTTGATATGAAACTCCTATTAACAGTCTTTTTTTGAAATAAAAAGTAGCTTGAGCT
TTCTTTTAAAATCATGTATCTTGATTGTTGATTTAATGAAGGATTTCCTTTTAATGCTGC
TTTTGAGCTTCAAGGTAATAGGACAGCAGGAACCTAAAATATCTGCCATCATCTGCCATA
GGAAAGATACCCAGAGACCCATCATGTTCTCTTTTTGTTGTTACACTGTTGGGTGGGTAT
AACAATTGGAAAATGAACAAACTGATTGATTGTGCAAACTACTTTTTATGACAAGCCTAA
ACCCTCATAATGCGGCAGCTTAAAGTGTATACATATGCACTAACTTTGATCAATTATATT
CTCATATCTGTTAGCTACACAGTCTCCTATTATCTCAATTGCTTATGTGCATATGGAATA
TGTTACTTAAAACGTGTGCATTCTTACTGAAAATGTTTTCAAAGGAAGGTATCAGCTGTG
GGCTAATTGCCACCAATTTCAGCCTGCCACGATTCTTGGAAATATGTCTTCCAAGTGCCA
TCCATCATCAGTAGGACAAGTGTCGGGAGTTTGTTTATTTTTTTCCAGTAGCAACGATGG
GTTACATGGAGCCATGAAACCTCCTTCTGGCCTCCCTTGTGATTAATGGCATGTGTTTGT
AAAATGGATAGCTGGGGTTGGCAGATGGCTAGAGAAGAATCGCCTTTGGTTTAAAATGTA
TGTGGTCCCCTAATGATTGTGACCCCATTCTGTAATCAACTGAGCTAGTTCCAATAAAGT
TAAGCAGGTTTAAATCCACTTTGTGCCTATCTTTTCACTGACAATAAAGTTAGCTATTTT
AAAATGCAGTACCGTGTGGAAAATGCTTTGGTGTTTACCCGACAGAGGCTTTATTTGTGC
TGTATCAGTGATTACTTTCAATTCAGTATGCAGTGAAATTGCCTTTCAAGGGCAGCGTGC
AGCAGAATTTGCATTTGCTTGAAGTATGGAATGTGATTATAGATTATAAAGTATTAAGAC
AACACCACAGGCCGCATGCTCTAATCGGTCTCTTTATATACTCAGGCAGCATATATTAAA
AGCTTTGCATCTTTTTATCTTCTGGTTTCTAGGGATAAAATGATGGCCACCCAAAGCAGA
GAATTTATCCTTTGGTTAGCATTTTGGAAGGCCCCTTGATATTCCTTTTGTACCCTTGTT
CTGATGCCAATTCATCAGTTTT
ggttgagggagcttgttattaaaaacaaatcaaaaccacaaacgagttggctcttcactg
aaaatgttaaggctgcctttacactgccctttctgtgcctcctgtttaccaatgagttcc
aaacctgactggtgaggcaaggatccccaaggactttgaaatgacacgttttcacagtga