--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28267 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1231       1338   0    Initial    108    80        Good
gccggggcggggggtgggagcccggggcccgcgcaggcggagatgtcgcccaatgggaag
ggtcggtcgggaagggggtgggcgcaggcgggtgggcgggaagaacgctggaggttgatt
ggcggtcttgccggccagtgaagccagggcatgggcggggcgcggctcggagcgcgaaac
ATGGCGGGGCAGGACGCTGGCTGCGGCCGTGGCGGCGACGACTACTCAGAGGACGAGGGC
GACAGCAGCGTGTCCAGGGCGGCTGTGGAGGTGTTCGGGAAGCTGAAG
gtgctgttggcccagaaagccactccagggcgggggaccggggagggccccgcccgaggc
ccgggagggcttgctgcggaagtccgcggcgccacgcggccaccgtcgccggttccggct
gcgccctgttcccttgcagcagggggtgcttgtggatcattcatctttgccctttggtgt

Exon  2 +       2527       2642   0   Internal    116    71        Good
aggcaggagaattgctggaacccaggaggtggaggctgcagtgagccgagatcatgccac
tgcactccatccaggctgggcgacagagtgagactccgtctcaaaaataaataaataaat
aaaatgaaatgatgtacactgggactttcagtgaatgttgctttccttttccttgcttag
GACCTAAACTGCCCCTTCCTCGAGGGTCTGTATATCACAGAGCCAAAGACAATTCAGGAA
CTGCTGTGCAGCCCCTCAGAGTACCGCTTGGAGATCCTAGAGTGGATGTGTACCCG
gtaatgcatcagtttcttcctcttcccacctggggtgtgcatgggcgccagccagcccca
cctggggaagatggggtttgtggttactgtgagtagctgtcttcccagagggctccaccc
cctagcctggaccctcgtgagaacagctgtgtaggtaaggagtactggtgacaggcatga

Exon  3 +       7328       7385   2   Terminal     58    64    Marginal
tctatcatttcttggtagaaaccgtgcttaacctggtaatgaatgttggataaaggtgag
caaaactgcagtccccaagttggtggctaacttttcatcttcatggtgatctctctagaa
gttggtggaatgtcaaaggtcaaatttttcatgggcctgtgtctgttctggccactccag
GGTAGATAAGCTGGACCCTGGAGTCCTGATCCGTGCCCCAGCTGGCATTGCCACATGA
gttatctggggccagttcttcctgtgctgaagtgggccagaagaaggaggtgttgtttta
gagcagccggtgggctggcctgggccacacagaggcactgcccttctccctggagctgcc
gtgtctggtacattccagattctctgacccacaccaacacatgtgtgacccgacccagcc

Exon  4 +       8843       8871   2   Internal     29    58    Marginal
tggaacaaggtcttccacccccagggctgctggcagggtgatagcagatgatggcacgaa
ggtcctttaggacatggccagatgggagcggtgagtccatttgctttggccttgtgaggt
cttggagagagtggcagacagtgcactgtagaggttcactgacccctgtccactcctcag
GCAGCTGCTGGCTTCTGCTCAAAGCCAGA
gtgagtgaccccaaacctgggagagcattgggtacaattcctaattttcagacgaggaag
ctgatgcccagagaggggtggggccactcagcaagaggcagcgctggcacctgggtgcct
gcctcctggcccaccctggtctcctatacccagtctagtctgtgggtgctgggcttcctg

Exon  5 +       9117       9178   1   Internal     62    88        Good
gcccagagaggggtggggccactcagcaagaggcagcgctggcacctgggtgcctgcctc
ctggcccaccctggtctcctatacccagtctagtctgtgggtgctgggcttcctgggtgt
ctgctgtcccctgctgtctgggcaggtgcctgccatgatgggctctttgtgtttcaacag
AAATGACGAAGCTGGGCCACGAGCTGATGCTGTGTGCGCCAGATGACCAGGAGCTCCTCA
AG
gtaagagggcctctgtctgctctgcagacggcacgcacgctttctgccctgggcagggaa
cctcatggtgctggctgaggtgggaggattttcctcccctagtgcctttgaggttcctca
ggccctggggccggctgggtgcccgggcaggctgcttctctaggcatccctggggccaga

Exon  6 +      14560      14651   0   Internal     92   100   Excellent
gcagggagcacttgctagtccaagacattgctgggcaggcacagggtcgttgatgggcca
ggcccctcctttcccctggctcctggcatgggtggcatgtgggggcaggggcactgggga
cagctggccttggcctggcttagatggagccagtgaatgtctgtggtcttccttgcccag
GGCTGTGCCTGCGCCCAGAAGCAGCTACACTTCATGGACCAGTTGCTCGATACCATCCGG
AGCCTGACCATTGGGTGCTCCAGTTGCTCGAG
gtaaaggtgtggatggcccaggtgggcagtattgacgggcttctcttggtcctagttctg
gagctggtaggggctggggtgtcactccccctctgatgctggctggggtgtgacacccca
cttggggatctggctggccaatcaggggccgggcagcatacgggcaaggggcagctgtgt

Exon  7 +      15137      15295   2   Internal    159    94   Excellent
aggcgggcaaaaatggaggagccagggcagacaggtggggcaggattctgcgcggtgggg
cttgtcctggcctctgtgcctggccccgatgtgcttctggggccttccctgtggggctga
gggcctgctgggcgagtgctctggcctgtgacggtgtggccctgggggctgcctttgcag
CCTGATGGAGCACTTCGAGGACACCAGGGAGAAGAACGAGGCCTTGCTGGGGGAGCTCTT
CTCTAGCCCCCACCTGCAGATGCTCCTGAATCCAGAGTGCGACCCGTGGCCCCTGGACAT
GCAGCCCCTCCTCAACAAGCAGAGTGATGACTGGCAGTG
gtacgtgctcctggaggcctcagtggcagcaccctggcctcctgtcccagccccaggctg
cttggttctgttactgcagacacccctggcagcggtgagttgcaagtgttccctttctct
ccctgcagggccagtgcctctgccaagtccgaggaggaggagaagctggcggagcttgcc

Exon  8 +      15424      15523   2   Internal    100   100   Excellent
ggcccctggacatgcagcccctcctcaacaagcagagtgatgactggcagtggtacgtgc
tcctggaggcctcagtggcagcaccctggcctcctgtcccagccccaggctgcttggttc
tgttactgcagacacccctggcagcggtgagttgcaagtgttccctttctctccctgcag
GGCCAGTGCCTCTGCCAAGTCCGAGGAGGAGGAGAAGCTGGCGGAGCTTGCCAGGCAGCT
GCAGGAGAGTGCTGCCAAGTTGCACGCGCTTAGAACGGAG
gtgagggtgctagctcctgggagggggttgcttggaggcaaggccctgctttgtcacctc
cctcagcacgtgaggcttaggcgaggttgcctgtgcaccgggcctgacatgttctagaat
actgtggtgctcagtccgcggggaggtgagaggtgggtcccgtggctgggggaagggatc

Exon  9 +      16022      16246   0   Internal    225    96   Excellent
gctgaggctgggagccagaaggtcttgctctggcctgagtcgctcggtacagctcccctg
tgtccctgtttctgaaagctttcttcctcgccctgggtgtgcagtgtctgaggtgagggc
cggtggcagcctggctggtgggcagggcagcctcaagggactctgcctctggctttgcag
TACTTTGCACAGCATGAGCAAGGGGCTGCTGCGGGCGCAGCCGACATCAGCACCCTAGAC
CAGAAGCTGCGTCTGGTCACTTCCGACTTCCACCAGCTAATCTTGGCTTTTCTCCAAGTC
TACGACGACGAGCTGGGCGAGTGCTGCCAGCGCCCAGGCCCTGACCTCCACCCGTGCGGC
CCCATCATCCAGGCCACGCACCAGAATCTGACTTCCTACAGCCAA
gtaagggtgcccttcccctcccctctaaccgccccctcccctgttcactcagactgagag
cttatatcctgcttgggctcaggggcctcagcagcccctgacaagggaccacagggcagg
accaggggctgggaggggctgggctgggctccctgctggccagtggcgtggcagggctct

Exon 10 +      17280      17394   0   Internal    115   100   Excellent
attggtgacttccccgctgggagttctgtccctcacccttggctgtctttcaggtgaatg
ccacctgatcagtgtgagtgggggtgggaagcaggagatgccgtcgctacgtgagaccag
cggcatttagtgcctgctcgctccctccctccctccctccctccctccctccctccccag
CTGCTGCAAGTGGTCATGGCAGTTGCTGACACCTCTGCGAAGGCCGTGGAGACCGTGAAG
AAGCAGCAAGGCGAGCAGATCTGCTGGGGTGGCAGCAGCTCCGTCATGAGTCTAG
gtacgtggctgcccacctggccctctgcctggggctgccccacgcacaggcttccttttc
tgtgctccactagccctggaggagcatttggggaccggccccttcttttgtttttcattt
tctaatgcatgttttccttcacttgaaaaaatgctttcagcggattatcaaatgaaaacg

Exon 11 +      23879      23910   1   Terminal     32    50    Marginal
gcatgtgtctgtatagcagcatgatttatagtcctttgggtatatacccagtaatgggat
ggctgggtcaaatggtatttctagttctagatccctgaggaatcgccacactgacttcca
caatggtggaactagtttacactcccaccatccttttggtttcttttctttcctctgcag
CTACCAAGATGAATGAACTAATGGAGAAATAG
aaagtcttcagtgatggcctacgccaaagcacaggatggggcgggcaggaagccctctcc
caagatcgagttggccgaggatggatgattgtggcagcagaagccgttgcagccccacgt
tgtgctctaggcagggacctttggcccctttggggagggagagacagacgggcggtttga

Exon 12 +      25991      26044   0    Initial     54    53    Marginal
gtctccccgggagcctgggggcaagcaggcagaggccagctcgggaccagcacctgtgtg
ccagggacaagggtggggaggtcgagcccagcgggagctgggtgcactgcatgggctctt
tcgggtggctgcttgcctgcttcccggcagctggttccagggctggagacccagtgtgct
ATGCCCCAGGTTCCCAGCCAAGGCATTCCGGTGAAGGGGCTGGACCCCGCCAAG
gtgcggtccctgagctgcctctgcctctcccaatccctgctggggactgtggctggaggc
aggcagtagagcgctctgaggcctgccttttctgttcagtaggtgacaggagtggggctg
acgctcccagagccaaaggtcacaggtgctgtggtcgggggtggcaggaagtgagcccca

Exon 13 +      26358      27068   0     Single    711    90   Excellent
caaaggtcacaggtgctgtggtcgggggtggcaggaagtgagccccagaagggtcagagc
tttggctagggggaggatggtacacagcagggcccgggcgaacccctctctccagtcctc
agggtttgtgcctctcgctcggacagtttgaggacttgctatccccgtgggaacatcacc
ATGTCCGAGGCACCCCGGGCCGAGACCTTTGTCTTCCTGGACCTGGAAGCCACTGGGCTC
CCCAGTGTGGAGCCCGAGATTGCCGAGCTGTCCCTCTTTGCTGTCCACCGCTCCTCCCTG
GAGAACCCGGAGCACGACGAGTCTGGTGCCCTAGTATTGCCCCGGGTCCTGGACAAGCTC
ACGCTGTGCATGTGCCCGGAGCGCCCCTTCACTGCCAAGGCCAGCGAGATCACCGGCCTG
AGCAGTGAGGGCCTGGCGCGATGCCGGAAGGCTGGCTTTGATGGCGCCGTGGTGCGGACG
CTGCAGGCCTTCCTGAGCCGCCAGGCAGGGCCCATCTGCCTTGTGGCCCACAATGGCTTT
GATTATGATTTCCCCCTGCTGTGTGCCGAGCTGCGGCGCCTGGGTGCCCGCCTGCCCCGG
GACACTGTCTGCCTGGACACGCTGCCGGCCCTGCGGGGCCTGGACCGCGCCCACAGCCAC
GGCACCCGGGCCCGGGGCCGCCAGGGTTACAGCCTCGGCAGCCTCTTCCACCGCTACTTC
CGGGCAGAGCCAAGCGCAGCCCACTCAGCCGAGGGCGACGTGCACACCCTGCTCCTGATC
TTCCTGCACCGCGCCGCAGAGCTGCTCGCCTGGGCCGATGAGCAGGCCCGTGGGTGGGCC
CACATCGAGCCCATGTACTTGCCGCCTGATGACCCCAGCCTGGAGGCCTGA
gcaccagggccacctcctgtgccatggacagtgccagcctccaccgttcagctggcctct
accacccccggctcctcctatctgggcagcctcaggtccgtgcacctgccaggccttccc
tggctgcctgaccagccatacggccctggattcctctccaggccccgcttccagggccgt

--------------------------------------------------------------------------------