--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (17149 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1439       1554   0    Initial    116    95   Excellent
cgggggatgactcacagcccatcccatctcccagacgccgcccgcccgcgcagtgctagc
tccatggcttagcggaggaggcggcagtggcgagctggggggaggggggactcttatttt
gttagggggaccgggccgaggcccgaccggcctggcagggctcgcccggggccgggcgtc
ATGTCTCATGCGGCCGAACCAGCTCGGGATGGCGTAGAGGCCAGCGCGGAGGGCCCTCGA
GCCGTGTTCGTGCTGTTGGAGGAGCGCAGGCCGGCCGACTCGGCTCAGCTGCTCAG
gtgcggggccgcctggggctgggagtgccgactggggctcccaggggcctgatctcgggg
gcagcgggggccccggactgggattggaggccctcggcctagccttggaggacgtcgggg
cgcccgtcttgggggggcacctaaggaatccggcagtggcctgcttggattgtggcttta

Exon  2 +       4096       4209   2   Internal    114    69    Marginal
gatgggggaaggaggtgggaattcatggtggtgtggtacccagcaaggtggccaaatatg
aggggcttgtaccctcctcttcgttctcccccgctctctgtctctttctctgtctcaggg
gagggctggggaataaggtccttcattcaatcactgaccaccactccacctccccctcag
CCTGAACTCTTTGCTTCCGGAATCCGGGATTGTTGCTGACATAGAATTAGAAAACGTCCT
TGATCCTGACAGCTTCTACGAGCTCAAAAGCCAACCCTTACCCCTTCGCTCAAG
gtatgtatgacttgtctatctgattcccctcccaattcctcagccctcctctcccctctt
gatgggcagaggccctcagtaccagcccaacccattctttcaccagcctgcgttttctag
tggtggtaaaattagggaccagaaagagcatgtcacacaggaaagtaggtggccaagcta

Exon  3 +       5256       5364   0   Internal    109    86        Good
ctgtgacccctgagagccatcaccaagcctggttcctgtgtctctgcttctacattgtgg
cctcggaaggcagagaacaggcctggttcctgtgtctgctccgtcacgctaagacccttt
aggcttgggatgagacttttagcttacctaaaatatggccccatatttcccattccacag
CCTCCCAATATCACTGCAGGCCACACCAGCCACCCCAGCTACACTCTCTGCATCGTCTTC
TGCAGGGGGCTCCAGGACCCCTGCCATGTCGTCATCTTCTTCATCGAGG
gtcttgctgcggcagcagctaatgcgggcccaggcgcaggagcaggagaggcgtgagcgt
cgggaacaggccgccgcggctcccttccccagtcctgcacctgcctctcctgccatctct
gtggttggcgtctctgctgggggccacacattgagccgtccaccccctgctcaggtgccc

Exon  4 +       5386       5559   0    Initial    174    45    Marginal
tgagacttttagcttacctaaaatatggccccatatttcccattccacagcctcccaata
tcactgcaggccacaccagccaccccagctacactctctgcatcgtcttctgcagggggc
tccaggacccctgccatgtcgtcatcttcttcatcgagggtcttgctgcggcagcagcta
ATGCGGGCCCAGGCGCAGGAGCAGGAGAGGCGTGAGCGTCGGGAACAGGCCGCCGCGGCT
CCCTTCCCCAGTCCTGCACCTGCCTCTCCTGCCATCTCTGTGGTTGGCGTCTCTGCTGGG
GGCCACACATTGAGCCGTCCACCCCCTGCTCAGGTGCCCAGGGAGGTGCTCAAG
gtaaggtgagatccagaggccctgggagggggctcctggtgactgaggagtgatcctagg
agctagggatggcctcgatgcactggtgatttgggggcaaggtcttaggggctctaagga
aggtccctggtactgtttaaattatctgtgttcatgtctcatgtgttttgggtttctgag

Exon  5 +       6411       6469   1   Internal     59    98   Excellent
cccatctggagaacccaacgcgctaccacctgcagcaggcgcgccggcagcaggtgaaac
agtacctgtccaccacactcgggcccaagctggcttcccaggccctcaccccaccgccgg
ggcccgcaagtgcccagccactgcctgcccctgaggctgcccacactaccggccccacag
GCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAGAAGGAG
gtaagaggctacagccaaacctcctcccacattcccctcccaaattcttctaaacctgta
taatatttacttcttcccctagattgatgatgtcattgatgagatcatcagcctggagtc
cagttacaatgatgaaatgctcagctatctgcccggaggcaccacaggactgcagctccc

Exon  6 +       6552       6656   0   Internal    105   100   Excellent
tgcctgcccctgaggctgcccacactaccggccccacaggcagtgcgcccaacagcccca
tggcgctgctcaccatcgggtccagctcagagaaggaggtaagaggctacagccaaacct
cctcccacattcccctcccaaattcttctaaacctgtataatatttacttcttcccctag
ATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTC
AGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACG
gtgaggccctgagatgggaggttggtctgaaaattagggcatttctgtatcaccaagacc
atactcagtctggctgtgtgtataggagacccttgccttgattgtgctaagatagagagg
gaggccttatgacgagaacagggtatgtcaacaatgcctttggaccttgttggactgtgt

Exon  7 +      10426      10547   0   Internal    122   100   Excellent
tggtcgccatgtgaatttgccttgaaggagaagcaagggttctggtgctgagtcagccag
tccttgcattagagggtgccccatctttgggatatgtggaagctcaggaacctggttctg
aggaggagccaagcctgggtttgttcccaactggtggttctctgccctctctgcccccag
CTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCC
ATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTGGT
AG
gtgatagggtcttggccccatggccctacactttaccccaggtgagccctgtgcctacca
ggtctagagatgggcctgattctgaggggaatggtttggacatatggaaatggaggctgt
ttgtcccctttccccctatggcttgtggtcttgctttcaccccacttcagttcctctcgt

Exon  8 +      10895      10951   1   Internal     57    64    Marginal
cagttcctctcgtcttggatttaacaaccagcctatcaccatggcttaaaatagtaaaaa
gaaggcactttttaaaaaaggcatttcccctgcttttggctaccaaaccctaccttagta
tctgcatgtgtttcttgccttcctgtgctcagaggccctgatcactccactcttttccag
AGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAA
gtaagccagagagcgtgtgcattgcccgggtgctgtgcaggcctgcctcaccccgagtcc
tggccccccatggggaactccttccctgcaacagcctcccaactccctactttctgtctc
ttccatttttggctaattgacaactctttctcccactctttcttcctctcctcccctctc

Exon  9 +      11150      11212   2   Internal     63    82        Good
gcattgcccgggtgctgtgcaggcctgcctcaccccgagtcctggccccccatggggaac
tccttccctgcaacagcctcccaactccctactttctgtctcttccatttttggctaatt
gacaactctttctcccactctttcttcctctcctcccctctccaaagttgagcgtcgcag
GCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCCCTAAGTCCAGTGA
CCC
gtgagtctgggctgggaccctcaggccagcgggaggtggggcaggcgtcccatgctacta
aaattgtgccttggtgggctcaccaggcagtctcggcccaggcatttctcctctgtctgg
ttctttctcagcctgagcagggttgcagaccctcactatgtcagcacctaaaattttagg

Exon 10 +      13133      13280   2   Internal    148    95   Excellent
ggcaccattgtaagattccaggcgggaagttttcctctggatactccatacctttgaaag
accccagcctcaagttctaagcatgtggtgggaggctcccacctggtgcaatccccgcct
cagctcctgagaaactcctcatgtggcatttcctgcttgcctcccacttgggccccacag
GGAGATGCGCTGGAACAAGGGCACCATCCTGAAGGCCTCTGTGGATTATATCCGCAAGCT
GCAGAAGGAGCAGCAGCGCTCCAAAGACCTGGAGAGCCGGCAGCGATCCCTGGAGCAGGC
CAACCGCAGCCTGCAGCTCCGAATTCAG
gtttgaaaagaggagatggtggtgggggaagagggggagagcttcctgcaggtggaggca
gagagagagcaggccagggtttcccttcctggcatacttgggggatccctgggcttccca
gatcacacgatgatgatagtgataatgataaataataatcataatattaacaaggataat

Exon 11 +      14080      14523   0   Terminal    444    73        Good
tacagtttgcgactctgaagcttcagagatgttaagcaccttgcctaaagttttggaact
agtgagtagcagaagctgaattccaacccagggaacctacccttttcaacctttatactc
ctctgcctctgagggactctgaaccctacttatcctgcacccaacccctattttttacag
GAACTAGAACTGCAGGCCCAGATCCATGGCCTGCCAGTACCTCCCACTCCAGGGCTGCTT
TCCTTGGCCACGACTTCGGCTTCTGACAGCCTCAAGCCAGAGCAGCTGGACATTGAGGAG
GAGGGCAGGCCAGGCGCAGCAACGTTCCATGTAGGGGGGGGACCTGCCCAGAATGCTCCC
CATCAGCAGCCCCCTGCACCGCCCTCAGATGCCCTTCTGGACCTGCACTTTCCCAGCGAC
CACCTGGGGGACCTGGGAGACCCCTTCCACCTGGGGCTGGAGGACATTCTGATGGAGGAG
GAGGAGGGGGTGGTGGGAGGACTGTCGGGGGGTGCCCTGTCCCCACTGCGGGCTGCCTCC
GATCCCCTGCTCTCTTCAGTGTCCCCTGCTGTCTCCAAGGCCAGCAGCCGCCGCAGCAGC
TTCAGCATGGAAGAGGAGTCCTGA
tcaggcctcacccctcccctgggactttcccacccaggaaaggaggaccagtcaggatga
ggccccgccttttcccccaccctcccatgagactgccctgcccaggtatcctgggggaag
aggagatgtgatcaggccccacccctgtaatcaggcaaggaggaggagtcagatgaggcc

Exon 12 +      14678      14837   1   Internal    160    73        Good
gcttcagcatggaagaggagtcctgatcaggcctcacccctcccctgggactttcccacc
caggaaaggaggaccagtcaggatgaggccccgccttttcccccaccctcccatgagact
gccctgcccaggtatcctgggggaagaggagatgtgatcaggccccacccctgtaatcag
GCAAGGAGGAGGAGTCAGATGAGGCCCTGCACCTTCCCCAAAGGAACCGCCCAGTGCAGG
TATTTCAGAAGGAGAAGGCTGGAGAAGGACATGAGATCAGGGCCTGCCCCCTGGGGATCA
CAGCCTCACCCCTGCCCCTGTGGGACTCATCCTTGCCCAG
gtgagggaaggagacaggatgaggtctcgaccctgtcccctagggactgtcctagccagg
tctcctgggaaagggagatgtcaggatgttgctccatcctttgtcttggaaccaccagtc
tagtccgtcctggcacagaagaggagtcaagtaatggaggtcccagccctgggggtttaa

--------------------------------------------------------------------------------