--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14780 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1174       1236   0   Internal     63    66    Marginal
cgcacgctctcacggctccagcctccgggccggaatggctgccggtgagactgtggtaca
acccgctgtgcgcaggcgcgtggcgggcaaggagggggcgcgaggggcggggctgcagcc
gcctgggctgttccaacgagcgcgcgccgcccccgccgcgccccgcgccgcccttgctag
CCGAGCCTCCCGCCCCCTGCATTGCTGATGCTGCTGCTGGCGGACATGGACGTGGTGAAT
CAG
gtacgcgctccagcaccgtggacagagcccgccgccgcccggctgcctaggccgggtcgc
tcaggccagccgactctgggaggtggtggccagggtctggcagcggagacccggtccccg
gcgctggggatgggggtctgcggcaggtgaaggggaggaagggggaggtggagaaaagga

Exon  2 +       2354       2419   0   Internal     66   100   Excellent
accttcccaccagtccttggaccctggggctcacaccatccccaaggtgtcactttctcc
ttctcaccctctccccgaggtcacatgctccatcccctggggtcattgatgggcagcctt
gccgctcacctccctgtacctccaacaaccccaccccttccccactgtttctctcctcag
CTGGTGGCTGGGGGTCAGTTCCGGGTGGTCAAGGAGCCCCTCGGCTTTGTGAAGGTGCTG
CAATGG
gtgagtgtggtccgggctgttggggcagagtgcagggagagagggaggtcatggggtcca
gaagagcaggggtggagtaggggcgagtagccagggatgagtgcgggggttgtaggggat
gggggaattgggctccagggtgaggtttcaggggtctgaagccagaaaacagatgagctg

Exon  3 +       3482       3672   0   Internal    191    94   Excellent
gagaagagggaggtcagcatggaaaggcagagacagagagagacacagagagagaaacag
gaagagacagccatacccttgtaatcagcttgtccttggtcccgatgagccctgattagg
gggtgggggtggggactgctccatctgctgctgcctgtgctgggcccccgatctgtccag
AGGAGGGCACCTCCCTCCCACATGCACACAGGTTCACTGTGGCCATCCCCATCCCTGCTG
CCCAAGGTCTTCGCCATCTTCGCCTTTGCCACATGCGGCAGCTACAGTGGGGAGCTCCAG
CTGAGCGTGGATTGTGCCAACAAGACCGAGAGTGACCTCAGCATCGAGGTCGAGTTCGAG
TACCCCTTCAG
gtgtgctcccaccctgggataccaacagacctgggagaggaaggggcagggtggaaccgg
ccaatacctccccccgcaagtagctcctgcccagctcccacctcgaggctacatccactg
ggatcactgagcacctgccttgtacctggcactgctctggactctaggactatgtggtga

Exon  4 +       7028       7223   2   Internal    196    98   Excellent
tatctcaccaggatgttttgagcaatcagtgaaatgtgactggtacatagtaggtgctcg
atgaatggttatttcctcctcttcctggggccttgtcagaaatggggggacccatgattg
ggctggagggttgagggtgttctgaggggctgggccacacctgcccacctctgtttgcag
GCTGCACCAAGTGTACTTTGATGCACCCACCTGCCGAGGGGGCACCACCAAGGTCTTCTT
AGTTGGGGACTACTCCTCGTCAGCCGAATTCTTTGTCACCGTGGCCGTGTTTGCCTTCCT
CTACTCCATGGGGGCTCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAATAA
CAAAGGGCCCATGCTG
gtgagtccccacagccacttgcatgtagggaccatggggacacggaaccccagggacaca
gccatgctcacagaccacaccaaatcccagacaggcccacatgcaaacagccaccataac
agccacacatatagttgctgctgctattaatccacaccaggcatccgggacacagagtca

Exon  5 +       7926       8117   0   Internal    192    97   Excellent
tacacacacaagctcaagctgggagggccaccttcaggtgaaagtgttgtgggcttgaga
gctgaaaaggcaggggagagacaggcctcttctgggggacctgtgatccgaggaggcccc
agggcctagcgtgaagcagtccactcacagtgctgtcttcctcacccctgcctgccttag
GACTTTCTGGCCACGGCTGTGTTCGCCTTCATGTGGCTAGTTAGCTCATCGGCATGGGCC
AAGGGGCTGTCAGATGTGAAGATGGCCACAGACCCAGAGAACATTATCAAGGAGATGCCT
GTCTGCCGCCAGACAGGGAACACATGCAAGGAGCTGAGAGACCCTGTGACCTCGGGACTC
AACACCTCGGTG
gtaagccctgggtgctggctggaggagggagagtggaaaacagtacagtccggcatgggg
agtggtggagtgggagaataagaggagagtcaggggagatccaaggggtgtccctgaaga
acgcgtgccaacaacaacgttgaaggatgagctagcaattgtaaccactgtgacaccaca

Exon  6 +       9626       9948   0   Internal    323    93   Excellent
accccgccagaggtgatttttctgcacatcgacgttctcgcactgggactcagagagtct
gggtttcagaaacccccaccttgcggagcctacggattcattccccgcatgctcattcct
gcacgcagggccgccaaggcaatgggcggggtaccacagccgagccttgtctccctgcag
GTGTTCGGCTTCCTGAACCTGGTGCTCTGGGTCGGCAACCTGTGGTTCGTGTTTAAGGAG
ACAGGCTGGGCCGCCCCGTTCCTGCGCGCGCCTCCCGGCGCCCCCGAGAAACAACCGGCA
CCCGGGGACGCCTACGGCGATGCAGGCTACGGGCAGGGCCCCGGCGGGTACGGGCCCCAG
GATTCCTACGGGCCTCAGGGCGGCTACCAGCCTGACTATGGTCAACCAGCCGGCAGCGGT
GGCAGTGGCTACGGGCCTCAGGGCGACTATGGGCAGCAAGGCTACGGCCCGCAGGGTGCA
CCCACCTCCTTCTCCAATCAGAT
gtagtctggtgagtgaccggcgagcggtgcggccaaggagggtacaaggaaggagacgag
cgggtcagtgaaccaataagagtcaggggtagagagtacgtaaggcgtttactggggcaa
gtaaggactgaagtttgaaggagccaatcaagaggcagaactacctgctaagagctgaaa

Exon  7 +      10284      10326   2   Internal     43    71        Good
cagaactacctgctaagagctgaaaaactagctaatgaatggagaaaagaagaatggtgc
ttcaagatggacagaatgaagagccaatgggagggaggtagaagggcaactcggcggaaa
ggcagggggagagaagcagagcaaccaataaagggagggaatatcgggggacttgcgcag
TGGCGAATCAGCGGAGCGCAAGAGCCACGGAAGCGACGAGGAG
gtgggtcttagaagtgactgataagccaataggtgataaggccaatagatggtgagggta
aatgggcgtggatcttgaaggtcagacgagctcaccaatccgggaggaggggatagatct
gccgcctctccccaacgctggaggggagggaagtagtgtggaatttcaaaggaggaagag

--------------------------------------------------------------------------------