--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (64065 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1236       1670   0     Single    435    76        Good
cagaggggcaaaggaacctggcagagcgagcttgggatgccgcggcccctttaagagcgg
cggcggcggcgcgcgctccgacggctacccccgggccccgcccctttcccgtgagccctc
ggggagtggtccgaccgcgggcggccgccggtgaggtaggggcgggaggcggggggagac
ATGGCTCGGCGCGGCTGGCGGCGGGCACCCCTCCGCCGTGGCGTCGGCAGCAGTCCCCGA
GCCCGCAGGCTCATGCGGCCCCTTTGGTTGCTCCTCGCAGTGGGCGTCTTTGACTGGGCA
GGGGCTTCGGACGGCGGCGGCGGAGAGGCTAGAGCCATGGACGAGGAGATCGTGTCCGAG
AAGCAAGCCGAGGAGAGCCACCGGCAGGACAGCGCCAACCTGCTCATCTTCATCCTGCTG
CTCACCCTCACCATTCTCACAATCTGGCTCTTCAAGCACCGCCGGGCCCGCTTCCTGCAC
GAAACCGGCCTGGCTATGATTTATGGCAAGTTCCTCAACCCTTGTCAGCCCCTTGGCGCT
GCCCCTTTCTCTGCCCGCCGGCTGCTTCGCCTCCTCTGCTGGCCCTGCTCGGCCTACGTT
CGGCTCCCCTTCTAA
ttccttccattttctgcctcgccttccccctaccccgcgtttctctgcctcacccccttt
cctcttcagcctcgcgccccattttatctgcctctccacacctttttcgcttccgacccc
accccctttttcctccgcacccccagccccccaccctttccctgcctaccaagctcggga

Exon  2 +       2231       2316   0   Internal     86    87        Good
tgctacgccctgtcctttcgaggttgcaaaggaaaatcttattcttgtggagtccgaaaa
aaaaaacccgaacgtgaaataggctacagaaggcttagggcatttttaatgacatcccat
ttattgtactatgcctctaatatctgatatggatacctgtggttgacccttccaattcag
GCATACAAAAGTGAGGACGAGGAAGAGTTAAGGTCCTTCCAGAAGTATAGTGTACTATAC
GATGATCAGGACAGTTCAGACAAACA
gtaattacaaacaccatgcatatgcagtatgggtgacttgctgttggcatgaggttattg
accgattgtagaataaatggcttcgattcttgtgtctcagtctgctttctgaggtttatt
attattattattattattattttggtgacaaggcgagaaggggtaaatcaaagtgtgggc

Exon  3 +      10519      10718   1   Internal    200    98   Excellent
ttgggctgtttgttgtatgaatttagtaatattttaaaacataactgcatttcatctaaa
aatcagttctgagctacagggaactaccgtaagagattttctcttatccatagttatgcg
tggggtacaaaagaagtggtctctgtcggcaagaagagcttatgttgttcttttttccag
GTCTTTTGGTGGGCCTTGTGCTTCGGTATGGCATTCATGTTCCGAGTGATGTAAATAATG
TGACCCTGAGCTGTGAAGTGCAGTCAAGTCCAACTACCTTACTGGTAAATGTTAGTGGAA
AATTTTATGAGTATATGCTGAAAGGAGAGATTAGTTCACATGAACTCAATAATGTTCAAG
ATAATGAAATGCTTAGAAAG
gtaagttcttaaaggaaatctttgaatcttttttgtgtctaactagcagcaaaatgatcc
aggagaaaataagtaatggatttttaatgatatttaaaataatgagtctttttcaatgga
gtaaaacctcaattaacaaatgtaataatgtaaggaaatggatatgtctgtacaactcat

Exon  4 +      14596      14701   0    Initial    106    66    Marginal
ggtaataagttgtttgaattttccttaaggccaaagtattaccatatttcaatgacatga
attaaatttgggattagtcacaaagtactacagtaaacccatcttcttactttatcctaa
tttttttaacagttgatatttttttctaaagtaggactgtgtttattgaacaggtcaata
ATGTATGGCTGTGTAACGCTGATGAAGGTAACGGGACAACTTGCAGGAGATTTTTACTTT
ACAGATTGCCTACTGTTTGGTGCCATTGTATCAGCAACTGATCCAG
gtatgttttatatgagtggagtttacatacttgaggtgcattgttttgcagtcaaataca
tgtgggtttttctttctttgaggtgtagaattcatgattagatacttccttagtactata
ctttctaattgtggaggaaaaaacaaaattcatgattccttttggcttcagcacaaattt

Exon  5 +      17841      17946   1   Internal    106   100   Excellent
aattagaaaagaaaaatatttatataaaattacggggtctttaatatggtaagagaatgt
ttattaggattgaattctaggaggaaatgaatttctaaataactctcagagtcatctact
gaggagaatatgttatatttgtaatgtctaagtattcctctgactctttttacttactag
TGACTGTTCTTGCTATATTCCACGAGCTTCAAGTTGATGTTGAACTCTATGCACTTCTTT
TTGGTGAAAGTGTCCTCAATGATGCTGTTGCCATAGTGCTGTCCTC
gtaagtgtttgttttcttattatattctgaatattaagtgtgagggtactaggaactgaa
agtcacttattgaataaagtacattatgaatggaaacatttggaagaatgaggcattttt
ttccctcttgaagaaatccatattttatagataaattggaaaatacagggaagagaaaaa

Exon  6 +      22489      22605   0     Single    117    44    Marginal
atacatggctgcatgaggtagatctatatgtatattgatatattatgttagatacggtat
atgtagttagagataaagtatacgttgcatagtattccactgaatggattaccgtgatta
gcctggggacctaaatccatattagtttaaaatatgttgtttacagtcatttatattttt
ATGAAAGAAGATGTACAGAGAGACAACAAACGTGATAAACTGTTTAACTTCACTAATTAC
CAGAGATACATGCTAGGATCAGTAGCCATTTCTACCTATTCAATTAACAAGACATAA
cttttttttttgagacagagttttgctctcgtcacccaggctggagtacaatggcgcggt
cttggctcactgctacctccgcctcccaggttcaagcgattctcctgccttagcctcccg
agtagctgggattacaggtgcacaccaccatgcccagctaatttttgtatttttagtaga

Exon  7 +      26175      26304   2   Internal    130    89        Good
ttttcttgctagccagatacattgcaggatttttgggtaattttgtccttattttggcaa
ttccaatcgaaagcttgtttttcttctccctctaatttcatctttcaagctctatactac
ataatgtttttttaaaagtaaaggttgttttcagaagtaaaagcagtctctcttctgtag
CTCAATAGTGGCATACCAGCCAGCTGGAGACAACAGTCACACCTTTGATGTCACAGCGAT
GTTCAAGTCTATTGGGATCTTCCTTGGAATCTTCAGTGGATCTTTTGCAATGGGTGCTGC
TACTGGAGTG
gtgacagctttaatatccttttgttatatttatcttttcttgttaacataatatagtagt
tgaatgctgtattccgttgtttttcctagttctatgattagaattatgttagaattatta
atcttataactaagtacttggtttgaaaacattaagcaacagtctttgccaataaataaa

Exon  8 +      27590      27640   0    Initial     51    51    Marginal
tatagtggcagacacaaacatgctagaagctttgacacttcacctctttggatctcagtg
taggaaattggagggtggggacggtaggaaagaggagtgggactagatgatgtctaaaga
gtttccagctctggcctggtgcagtggctcgtgcctgtaatcctagcactttgggaggcc
ATGGCGGGCGGATCACAAGGTCGGGAGATCGAGACCATCCTGGCCAACACG
gtgaaaccccgtctctactaaaaattcaaaaaattagccgggcatggtggtgggcgcctg
tagtcccagctactcgggaggctgaagcgggagaatggcatgaacccaggaggcggagct
tgcagtgagccgagatggtgccactgcactccagcctgggcgacagtgcgagactccgtc

Exon  9 +      32378      32505   0   Internal    128    73        Good
tggctttttctgcaggactagaaatgtcgtctccacatttgctcccttctgaaccacata
ttttgtgtgtatgcatgaagtttatatatatgagtgtctgttttaatatcttagtaatac
tcatgctttcaaattatgtaactttatttgctggactaatcttttacaatttcgtttcag
TTGTTTGAGCTTCTCAATTTCTTGGCAGAGAATTTCATCTTCTCCTACATGGGGCTGACA
CTGTTCACCTTCCAGAACCATGTCTTTAACCCAACATTTGTAGTAGGAGCATTTGTATCC
TTTATTAT
gtgttttattttgaaaatatttttaattgagattttcatgtgggttttgagtatgtggtt
cataagaatacatttaaatatatacagttttcctctgagtaaaacaaataaggattccag
ctcttttttctagtctatttattttattatattctatttcaatttgtggttattgcacaa

Exon 10 +      37604      37712   2   Terminal    109    83        Good
tcatttttgtatttttaatagagacaggtttttgccatgatggccaggctggtcttgaac
tcctggcctcaagctatcctcccgccccggtctcccaaaatgctgggattacaagtgtga
gccaccatgtctggccttgttctgtttttaatcttagattttcccttatatttttctcag
GAAATGGGATGGAGACTGTATCGTGACTCCTGAAATAAAAATTGCCATCATAAAGCAGGA
GTCCCATAGACAGCAAACTGGAGAAAAAGATACTAAAATTGGTTTCTAG
ttaaaaccaatctgaattcacattaaactttccctttgaagcaagttggaagtataaact
tagtggagtacagtgggactggtagccattttagtgctgtgaggtggtgattcagctgcc
cttttctttgttctgaggaaggaaggggaagttttctcagtattactcttcttcctacca

Exon 11 +      40077      40216   0    Initial    140    90   Excellent
ggtgtgagccaccatgcacagcctggacatatttaagtatgttaatatttactgcatatt
tgttcacatgcttctaagtttttagaacgtgctttcttgctctgaatttatgaagcttgc
attggtaatgagttattgaagaaataccttttctgttcccctgtaggccttcgtggtgca
ATGGCATTTGCCTTGGCCATTCGAGATACTGCCACTTATGCACGGCAAATGATGTTCAGC
ACCACGCTTCTGATTGTGTTTTTTACCGTGTGGGTATTTGGTGGTGGCACCACTGCAATG
CTGTCATGCTTGCATATCAG
gtaagtactaactagagacctcattttaagattaaattttaatttggtttatttttctgc
ctgttttcaatttttaatctttggagaatctgtaatgttttattttttccttttaaaaag
tatgtaatatatagtacagaaaaaggaaaatatatatgcaaaagaaaaattcattgttaa

Exon 12 +      49147      49236   0   Terminal     90    62    Marginal
aaacatttcaatttcctattccaaagctgcaatatacaaactattaaatttctaatgtta
cccttgttggagagtgtcttataatatagtagcctctatttctgattctccaaaggaatg
gctctaaataaatgttcatatctttgtatagatattgatttctgtattatctatctgcag
GGTGTTCCTGAAAATGAAAGGAGAACTACCAAAGCAGAGAGTGCTTGGCTTTTCCGGATG
TGGTACAACTTTGATCATAAGTATCCTTAA
ttgagggaaaaaaaaaaaggataatgtggacatagataattacagtttaatggaacaagt
gttttgactattctcttcctggagcagaatataaaacctacctttcatcttccctttccc
catcagtgctgtggaaaaggaaacccacacagacagattcctcttcaaacccatgaaacc

Exon 13 +      49841      49999   1   Internal    159    74        Good
ctgttcagcaatacacttttttttcccctgacctttccaaagactaggagattctctctg
ttcagcatgccacagatagctaatgtttttgtttgccagatttccttcttgccctgttgt
aagtctgtttcatagctgtactttgagtagtgttgatattctataacctctttaaatcag
GGATCCCCAACTCCCGGGCCGCGGACCAGTACTGGTCCGTGGCCTGTTGGGAACCGGGCC
ACACAGCAGGAGGTGAGCAATGGGCCAGTGAACATTACCACCTGAGCTCCGCCTCCTGTC
AGATGAGCAGCATTAGATTCTCACAGGAGCCCGAACCCT
gttgtgaactgcacttgcgagggatctaggttacatactccttatgagaatctaatgtct
gatgatgtgaggtggaacagttttatcccaaaactgttttgttcccagcccagtccatgg
aaaaattgtcttccacaaaaccggtccctggtgccaaaagagttggggaccactgcttta

Exon 14 +      55789      55914   0   Internal    126    60    Marginal
ccatatctgtgaagtggagatgataaaatacccctttgctgtttcactgccatcatgtga
ggaggaaatgagaccatagatgtgaaagccctttgctgtcctccgaagtggttactatac
tatgatggtgattattatcaaacgagttgctcttttaaatttgtaaagaaaggaccacag
CTCTTCCTTAACCACCGCAGCTATCTGAAGCCTCTGCTGACCCACAGCGGGCCTCCGCTG
ACAACAACACTCCCTGCCTGCTGTGGACCCATCGCCAGGTGCCTCACCAGCCCCCAGGCT
TACGAA
gtaagttggttttatccaaaactaaattcttcagtaagttaaatttatctgctctgtgga
tgagtcactggttttattttattttggtttgtttttttgcctttgaggtataaattccat
gaaagggaatttaagcatattttgctcaaccagaaaatacactgaaacctataaatataa

Exon 15 +      60185      60457   0   Terminal    273    97   Excellent
gaggaactaaggatgccaagtcacgctgtattttaagccaaggtatggactttagacttt
atcctgagggcagtgggctaccacttaagggttttaatgggggatcctcgaaaatactcc
tattggaaatgtctcttgaacttctcaaaaattcttaaatcttactttatttgcatttag
AACCAGGAACAGTTGAAAGATGATGATTCTGATCTTATTCTCAATGATGGTGACATCAGT
TTGACATATGGAGATTCTACTGTGAACACTGAACCGGCCACATCCAGCGCCCCAAGGAGA
TTTATGGGAAACAGTTCTGAAGATGCCTTGGATCGGGAGCTTGCATTTGGGGACCATGAA
CTGGTCATTCGAGGAACACGCCTGGTTCTTCCAATGGATGATTCTGAACCCCCGCTAAAT
TTGTTAGATAATACGAGACATGGTCCAGCCTAA
gcttactaatactcacttagtgatttgtaaaatttgcacatgtgattgtgaagaaatttg
tactacctaaaagtcccagtgcatgtctctgaatgtgtaagctatataaatgctatttat
atggcatagaaagaatataaatatcctgtacacggcagattgtgaacaaactatattcct

--------------------------------------------------------------------------------