--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11048 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1839       2100   0    Initial    262    76        Good
ccgcccgcgccccgcaccccgccgcccgcccgccgccccgtcccccggcccggccgcccc
ccggcccccggccggcccgcgccctcggggccctccccggtgccgccggtgccccccgcc
tgaccgccgccccccgtgaggcgccgcgaccccggcccggccgtgcggcccgccgaggcc
ATGGCGAAGAAGAGCGCCGAGAACGGCATCTATAGCGTGTCCGGCGACGAGAAGAAGGGC
CCCCTCATCGCGCCCGGGCCCGACGGGGCCCCGGCCAAGGGCGACGGCCCCGTGGGCCTG
GGGACACCCGGCGGCCGCCTGGCCGTGCCGCCGCGCGAGACCTGGACGCGCCAGATGGAC
TTCATCATGTCGTGCGTGGGCTTCGCCGTGGGCTTGGGCAACGTGTGGCGCTTCCCCTAC
CTGTGCTACAAGAACGGCGGAG
gtgagttcccccgcccgccgcggcctcctcccccagcaggccgccggcccccgcccgacc
cccggagccgccgcggaggggtgaagtccgggcaacgggtggcccccgggcacgcggggg
tcggggccgcccctcgtccgccgctgccgctcggtggccgggccgggcgcctccaccccc

Exon  2 +       3639       3770   1   Internal    132   100   Excellent
cttcaacacactcaacccaccccctcaagactccacctggggcctgagtcagtggccacc
cctacactgactcacccagtcggaagttgtgatggggcctttggagtctgggctggcccg
ctgggcctgggcagcctggctgggggccaccctgagtccacgctgtgcctccacccccag
GTGTGTTCCTTATTCCCTACGTCCTGATCGCCCTGGTTGGAGGAATCCCCATTTTCTTCT
TAGAGATCTCGCTGGGCCAGTTCATGAAGGCCGGCAGCATCAATGTCTGGAACATCTGTC
CCCTGTTCAAAG
gtgagcagcccttggccagcctcagggactgcccccttctcccagctggctcccacttga
gaaatcttttcctgtcgtgagcaccaggcctggggccacgtgatggcgtcccagtctcga
ggggggagcctggaggagatgttcaggccgcacagcgaacttggggaagcggggactaga

Exon  3 +       4568       4800   1   Internal    233   100   Excellent
gggagtcagcgcagtgttggggctcacacaagggggagcccaggggagtcaggagcacca
caaacaaggctccaggaggacagatggtgggagcacggccagcctgggtggggacataaa
ggggtggcagggggaggtggccagggaagaatctacatggcaaggacttcccggccccag
GCCTGGGCTACGCCTCCATGGTGATCGTCTTCTACTGCAACACCTACTACATCATGGTGC
TGGCCTGGGGCTTCTATTACCTGGTCAAGTCCTTTACCACCACGCTGCCCTGGGCCACAT
GTGGCCACACCTGGAACACTCCCGACTGCGTGGAGATCTTCCGCCATGAAGACTGTGCCA
ATGCCAGCCTGGCCAACCTCACCTGTGACCAGCTTGCTGACCGCCGGTCCCCT
gtcatcgagttctgggagtgagtccggcacctctgggccaagcccatcccatcccccagg
tctccctcatgttgcccggctccaggggagtggccctgagggggcaccagggtgttgcct
ggcagtccatcctggaccctgcctgcccttgcctgtcctcggagagtcctggggccagcc

Exon  4 +       6305       6439   0   Internal    135    93   Excellent
gcacttggccagggctgccggggcgcagccttgcccctagcttcctctggcgggagccat
ggctcggaggacaatggggacctctgaacatacctgcccgcaagggggaccggaggcgct
gggagtgggggtgtgagggaggtggtgccacagcctccgctgagcagcctggccccccag
ATCGTGTACTTCACTGCTACATTCCCCTACGTGGTCCTGGTCGTGCTGCTGGTGCGTGGA
GTGCTGCTGCCTGGCGCCCTGGATGGCATCATTTACTATCTCAAGCCTGACTGGTCAAAG
CTGGGGTCCCCTCAG
gtgaggtggaggtggagaggctgcagcagggcgctgcgggggagccctgcaggcccctca
tgcctgcgctctccggcccttctctaggtgtggatagatgcggggacccagattttcttt
tcttacgccattggcctgggggccctcacagccctgggcagctacaaccgcttcaacaac

Exon  5 +       6527       6630   0   Internal    104   100   Excellent
gtgctgctggtgcgtggagtgctgctgcctggcgccctggatggcatcatttactatctc
aagcctgactggtcaaagctggggtcccctcaggtgaggtggaggtggagaggctgcagc
agggcgctgcgggggagccctgcaggcccctcatgcctgcgctctccggcccttctctag
GTGTGGATAGATGCGGGGACCCAGATTTTCTTTTCTTACGCCATTGGCCTGGGGGCCCTC
ACAGCCCTGGGCAGCTACAACCGCTTCAACAACAACTGCTACAA
gtaagcaccgccgccctgccacccgtgccctgtcctgccctgccccgccctgcccagcag
cctaacccatccactctggcccctccacccctcagggacgccatcatcctggctctcatc
aacagtgggaccagcttctttgctggcttcgtggtcttctccatcctgggcttcatggct

Exon  6 +       6726       6850   2   Internal    125   100   Excellent
cccagattttcttttcttacgccattggcctgggggccctcacagccctgggcagctaca
accgcttcaacaacaactgctacaagtaagcaccgccgccctgccacccgtgccctgtcc
tgccctgccccgccctgcccagcagcctaacccatccactctggcccctccacccctcag
GGACGCCATCATCCTGGCTCTCATCAACAGTGGGACCAGCTTCTTTGCTGGCTTCGTGGT
CTTCTCCATCCTGGGCTTCATGGCTGCAGAGCAGGGCGTGCACATCTCCAAGGTGGCAGA
GTCAG
gtagggccctacccccagccccgcctccagagcagcgagtgctacccagatgcatgatgt
acaggaacatgcaatagaaatgctgaaaagtgacgaggattcaaacggaacttgtcagat
tgtgggcctgtgggggcaggtcctgggatttgtcaatgttgacagagaaaggacctccca

Exon  7 +       7169       7281   1   Internal    113    93   Excellent
ggtcctgggatttgtcaatgttgacagagaaaggacctcccagcccctgccgcacgaccc
agggttgacagcgcctctgaggcaggcgtgggcatgggcgcgagtgttgcaggcagggct
cagggtgcgcacagggcaggacatcggctacaaggtctagagcctgcacctttcccacag
GGCCGGGCCTGGCCTTCATCGCCTACCCGCGGGCTGTCACGCTGATGCCAGTGGCCCCAC
TCTGGGCTGCCCTGTTCTTCTTCATGCTGTTGCTGCTTGGTCTCGACAGCCAG
gtttgcatggggctctgggacagggagccaggaggggggcggagggagggctgcaggcaa
ggaaaggggtggagggcggtgcggggctcggcctgagctgccctggccacagtttgtagg
tgtggagggcttcatcaccggcctcctcgacctcctcccggcctcctactacttccgttt

Exon  8 +       7394       7531   0   Internal    138    96   Excellent
tgccagtggccccactctgggctgccctgttcttcttcatgctgttgctgcttggtctcg
acagccaggtttgcatggggctctgggacagggagccaggaggggggcggagggagggct
gcaggcaaggaaaggggtggagggcggtgcggggctcggcctgagctgccctggccacag
TTTGTAGGTGTGGAGGGCTTCATCACCGGCCTCCTCGACCTCCTCCCGGCCTCCTACTAC
TTCCGTTTCCAAAGGGAGATCTCTGTGGCCCTCTGTTGTGCCCTCTGCTTTGTCATCGAT
CTCTCCATGGTGACTGAT
gtgagtggggtggggggtctgcctgtgacctctggtggccgtctgccatcctccctgact
gggctctgtcccccagggcgggatgtacgtcttccagctgtttgactactactcggccag
cggcaccaccctgctctggcaggccttttgggagtgcgtggtggtggcctgggtgtacgg

Exon  9 +       7608       7710   0   Internal    103   100   Excellent
tcgacctcctcccggcctcctactacttccgtttccaaagggagatctctgtggccctct
gttgtgccctctgctttgtcatcgatctctccatggtgactgatgtgagtggggtggggg
gtctgcctgtgacctctggtggccgtctgccatcctccctgactgggctctgtcccccag
GGCGGGATGTACGTCTTCCAGCTGTTTGACTACTACTCGGCCAGCGGCACCACCCTGCTC
TGGCAGGCCTTTTGGGAGTGCGTGGTGGTGGCCTGGGTGTACG
gtaggtcatggctgagggctgggctgggggatggtggcggggaaggcaggtctccagctt
ggccctcccgcctcacctcgccgcaggagctgaccgcttcatggacgacattgcctgtat
gatcgggtaccgaccttgcccctggatgaaatggtgctggtccttcttcaccccgctggt

Exon 10 +       7797       7897   1   Internal    101   100   Excellent
tacgtcttccagctgtttgactactactcggccagcggcaccaccctgctctggcaggcc
ttttgggagtgcgtggtggtggcctgggtgtacggtaggtcatggctgagggctgggctg
ggggatggtggcggggaaggcaggtctccagcttggccctcccgcctcacctcgccgcag
GAGCTGACCGCTTCATGGACGACATTGCCTGTATGATCGGGTACCGACCTTGCCCCTGGA
TGAAATGGTGCTGGTCCTTCTTCACCCCGCTGGTCTGCATG
gtaagggctgggggaggtggggcagggcggggggcgaggcagggcggggtaggggcccca
ttaaccgcagcattctggtccgtagggcatcttcatcttcaacgttgtgtactacgagcc
gctggtctacaacaacacctacgtgtacccgtggtggggtgaggccatgggctgggcctt

Exon 11 +       7983       8153   0   Internal    171   100   Excellent
accgcttcatggacgacattgcctgtatgatcgggtaccgaccttgcccctggatgaaat
ggtgctggtccttcttcaccccgctggtctgcatggtaagggctgggggaggtggggcag
ggcggggggcgaggcagggcggggtaggggccccattaaccgcagcattctggtccgtag
GGCATCTTCATCTTCAACGTTGTGTACTACGAGCCGCTGGTCTACAACAACACCTACGTG
TACCCGTGGTGGGGTGAGGCCATGGGCTGGGCCTTCGCCCTGTCCTCCATGCTGTGCGTG
CCGCTGCACCTCCTGGGCTGCCTCCTCAGGGCCAAGGGCACCATGGCTGAG
gtaaggctcccgcccggcccgccctcccctcccctgctgtgaacattcaacccagcctgc
ttcctagccagggagtggccccgactagggtggcaggcagtgggaaccggagagaggcag
aggaagtcaccgtggggacgagcaggtgaccctgggggcttcagcatgtcctcctctcct

Exon 12 +       8338       8469   0   Internal    132    83        Good
ggctcccgcccggcccgccctcccctcccctgctgtgaacattcaacccagcctgcttcc
tagccagggagtggccccgactagggtggcaggcagtgggaaccggagagaggcagagga
agtcaccgtggggacgagcaggtgaccctgggggcttcagcatgtcctcctctcctgcag
CGCTGGCAGCACCTGACCCAGCCCATCTGGGGCCTCCACCACTTGGAGTACCGAGCTCAG
GACGCAGATGTCAGGGGCCTGACCACCCTGACCCCAGTGTCCGAGAGCAGCAAGGTCGTC
GTGGTGGAGAGT
gtcatgtgacaactcagctcacatcaccagctcacctctggtagccatagcagcccctgc
ttcagccccaccgcacccctccagggggcctgcctttccctgacacttttggggtctgcc
tgggggaggaggggagaaagcaccatgagtgctcactaaaacaactttttccatttttaa

Exon 13 +       8807       8873   0   Internal     67    49    Marginal
aaaacaactttttccatttttaataaaacgccaaaaatatcacaacccaccaaaaataga
tgcctctccccctccagccctagccgagctggtcctaggccccgcctagtgccccacccc
cacccacagtgctgcactcctcctgcccctgccacgcccaccccctgcccacctctccag
GCTCTGCTCTGCAGCACACCCGTGGGTGACCCCTCACCCCAGAAGCAGCAGTGGCAGCTT
GGGAAAT
gtgaggaagggaaggagggagagacgggagggaggagagagaggagaagggaggcagggg
aggggcagcagaaccaaggcaaatatttcagctgggctatacccctctccccatccctgt
tatagaagcttagagagccagccagcaatggaaccttctggttcctgcgccaatcgccac

--------------------------------------------------------------------------------