--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (113670 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1269   0    Initial     69    82        Good
cggcgtcgagccctctctggggccgccgccgctgctgctgctgctgccgctgccgctgcc
gctgccgccgccgccgccgccgccgccgctgccgtggggctcgggcggcgacggagcggg
gccggccgtggggcgggcggggagggaggaggcggtgaaggcggcgggccgggggggaag
ATGCCGCTGGCGCAGCTGGCGGACCCGTGGCAGAAGATGGCTGTGGAGAGCCCGTCCGAC
AGCGCTGAG
gtgagtgcagcagggcggccggggccggcgcatctcctcctcgcgcccccgccggctcgc
ttcgctccccggagctggccactcggcccgttctgatcccgctcgcgtctttcccccggg
ctcagggttttggtttgggttgttggggtgggtctattggccggtctgtctgttccttcc

Exon  2 +      27228      27264   2   Internal     37    65    Marginal
ttttctttgaggccctgattttaaccattgcatagtattcctacatatgaatagatgtat
tatgatttatttaaccagtcccttgttggtcatttagattgttttctatttttcagtata
atgagtatgatgaatatcactgtacataagtctttatgcacatctctgatatttccttag
GATAAATGAGGAGCTGATTCTTAATCCTGTCACATTG
gtaaggattatatacattccttattaagaatataaagtgcttgtttcttattgtttcatt
gtgattgcatagaagattctttggattctgaacaatttggtggtatcttaaccaaagttt
gagagaggtttctaatgcctcatgctcagcaccttcatgatggaattcctattgtgtaag

Exon  3 +      31304      31387   0    Initial     84    54    Marginal
gcactgtttctgtgcttcatagtattatataggcattccctcatctaggaacatcttcta
tgagtggtgaaaatgaaaggtgccctttgtataaggtcagtagaccttctaagatagggg
ctatgttttattaacttctgtctccagctcagtgcctagaacatagcttgaatgaaatga
ATGAATGGATGGATGGTAAATAGGGATGAGAAAAACAAAGAGGGGAGTTCATATTTAGAG
CAGCTGCCTCATGTGAAGTATGAG
gtgataggtgggctgccttttatttcccaggtgataatgttccaaagatggttagcttag
atccttgtatacttgttgaattaatagtcgggactactcctttttccagtaagggaatga
gagaagaagctacgtgttcctgacttccgtttttgtggtttttaaaaattacacaaataa

Exon  4 +      33019      33075   0   Internal     57    58    Marginal
ttttgaagcacatcctgttgcaaatttagcaactgcatactcatatggtggttctacttc
attagagccctttaggggtgaaaatcttcctcaattttttttttttttgtctgccttcat
ttaactttaactgatgtgaggtctgttttggtaacttcctgcttgctgtgcttttcacag
AATGGACAGCAAATTATGGATGAACCTATGGGAGAGGAGGAGATTAACCCACAAACT
gtaagtaaaatattttatcacaaagggtatagataaatgaaatactgtaaagttattatt
atttttcagctgagcagagtaatcattttacagtgttagaaacttgtcgatcctttcaca
ttaactttaccagactacattattgagtatgccagggacctttctaaaaactgtttgata

Exon  5 +      37046      37109   2   Terminal     64    55    Marginal
agttatagttttttacatacagttcttgtgcatttgttaagacaaattatgggtatttta
tagttgtatagtctttgttatgtcataagtgggattttttttctgctatgttttccatct
ggttattgcgtatgtatatttaaaatgttaggtgtttctatctgttttttagcatcttag
GAGTGTTAACTTTTCAGAAATCAAACAAATTGTCATGAACGTTATGTCAGTTGTGGAAGA
ATAA
gatcagtttaaccttctgcttaaaacacctccatagttttatggttcctttaaataaaaa
cccaacctccataacatgacctaccaggccctgcataataaggttttgcatacttctctc
cacatcctctctagccgcacacctctaccctctactgaaagtccagtcactcaaatgtat

Exon  6 +      40569      40692   0    Initial    124    44    Marginal
tttaaaatgcttagtgaaaatgattttcagccaagatattttcagatatggacctatttt
gggaagtcgctggaaaatgggctctgccaacactagagggttattaactaagtaagagag
acatgggatttggcaacaaaagatccagtactacaagcatgatgaaagtttattcccatt
ATGATGATTAAAGGAAGCTTCAGAAGACTAGTTCATTCAGTAAGCTTAGAGAGTACTCAG
TCCAGATTGAAGAAGACAGATAATTTCAAGAATGCTGCCTCCAGGAACAGGATTGGGGGA
AGAG
gtgggggaatagaagtgatgaatctaaatagacttgggtattgaaaattcacttgagagg
ctgttgcagagtaggaagaatttgaaataggtacaaagaaaataaaagcaaattaaaaaa
caaagcaactgtaaacttaaggaaaaacaaaaattgtacacaagagatgtaactaaagta

Exon  7 +      45923      46061   2   Terminal    139    80        Good
taggccatatgatctctcttgcaaatactcaactcggcggtagccattgtgggcaaacac
agttgaagataatatttaaacagagatggacatgggcagatttggcccttaggctggcca
ggcctggctgtagtttacccctgcccaaggtcttgatgtggttccttccttattattcag
GTTCTTCCTGGAGGACAACGTGCCAAATAAGTTAGGATCCAAAACCTTAATGCTGCATAC
TCTTGAATGTACAGTTCTACTTCTAGAAATTATTTCTAAATGTGAATGTGTACAAAGGAT
GGGACAGACCATCGTGTAG
agcaaagacccaacaataggagatttgtataatagaattttcaacagttcttaataatgc
attgaagattagagaacaggggtcagcaaactacactcatgggcctgtcacctgtttctg
taaaagatgttttattggaacgcagccttacccattcgttttctcactgcactggcagag

Exon  8 +      53474      53653   0    Initial    180    80        Good
aaaaaccagacctaccaaaaagtgtgactagactagcatcacccatctcatcagcagaac
tggatgctagaaggcaatggatctatggtgtcaaagttctgagccaagattatttttctt
ctggaatttggtactaagccaaactatacaaatgggaagacaaaataacaacatttacag
ATGTGTGAGGTTCAGAAAGTTTTCTTCCACATCACCTTTCTTTGGAAGTTACAAGGGGGT
AATCTAAGAAAGAGACATAGAAAACTGAAAACAGTGAATTCAACCAGAAAATCACTGAAG
ACCTATCCCAAGATGATAGCTGTGCAGCGGGCCTACAGAACCACCAATCCCGATGGGAGG

gtaagagaggtctccaggatagaaaggagctctcagaagaaaggaaaatattgctaaggg
ctaagaaaacattaagaatagtggtcaaattacttttccctttccccaagaatggtggaa
ggctgttaaaaataggaaaaaatagaaaagtgcatgataaattcatgatccaaatgggaa

Exon  9 +      58429      58545   0   Internal    117   100   Excellent
tcacttgatgggttggtaaaaggtggtttttgtatgttaatttgggatttctaatatgtt
tagaaattagattgatttctaattaatttctagtaagattaaattaatattgtttgattt
ttagcgggagaaaatagctctggctaaccctgtttgctcctcttacgtttatctcaacag
GAAGAAGTCAGTATCAAAGAAATTGCAATCACACATCATGTAAAGGAAGGACATGAAAAG
GCAGATCCTTCCCAGTTTGAACTTTTAAAAGTATTAGGGCAGGGATCATTTGGAAAG
gtaagtcatgagtgtgtgcttttttaagagttgtcttttcaattcatatgtatttcatat
acatgaggaaacaaatattttatgaaatgctaccagtcttcctaccagcaatgttttctg
tttttttacatttctcactatcagtaagtgggaaagtgaataaagttgttcaaaagtacg

Exon 10 +      58868      58937   1   Internal     70    83        Good
agtaagtgggaaagtgaataaagttgttcaaaagtacgttggagacttcagtaaattggt
actatttgcttcctactttatcttcaagagcacatgacctctccagttgtgattcttaaa
ttgttaaaaatcacaagatattcccttgatacactggcctctttttgagtccttgggtag
GGTTGGAAGGTGATCTTGCAATACAGCGCATCTCAGCCTCCCTTCCAGCGTACTCTAATA
CCAGCATAAA
gtgagtgacgctcccaaagaagtagggttgggggctaccgctacaattttgaagttttct
tgactcctggcttgtctttaaaatgaatgcaaagtttgcattttatccagtaacatcgtg
tttgtttttaatatcaaaaaatgtttcccaaagccaccaaggaaaattcctccagaaggc

Exon 11 +      61670      61785   0    Initial    116    68    Marginal
tagcatgcttctccctttacgtctttaaaagtaatttaaatatcatactataaataccaa
acattcaaaataggttgtctcctttcttactcattctgaaaggccacagtaagccaagga
aacagggatgacctgtcagagactagaatagcttcatgggggagtgagaaaaggtcagaa
ATGCTCTGGTGGAGGAAGAGATGGCAGCTGGGACCGCTGCTGCTCCTGCTGGGCTTGCCT
GGTTACTGGCCAAAGGGAACAGATAAACAGCACCCTGAGCAGAAGCAGAATACTGG
gtgactgacacggactctgtcccagtacctccactgtgacactgggcaaattacttaacc
ccctaagccctagtttggacagctataaaataggcattgcctagtaggtctgcctcccaa
aattgacacgatgatttattacaaatggttgtgaaagtattttgcaaactaagaagtgct

Exon 12 +      63730      63811   0   Internal     82   100   Excellent
ccccaagttataacaaatgtttataactagtatttataattgatacattttaggggaaat
aatctacagtatatctgaatctatattataataataaactgtattatagcagggtcttat
tttaacaaggatatagtttatactactttgtaatatttattttctcttacttaaatgcag
GTTTTCTTAGTTAAAAAAATCTCAGGCTCTGATGCTAGGCAGCTTTATGCCATGAAGGTA
TTGAAGAAGGCCACACTGAAAG
gtaagtgttgctgctatttgtaatgttcatgtagtctaaacaaactgaaaggtctcaata
gagctcatgggactccttggcatgttatttacattctgaataggttcctgttaccagctt
taaatttaggctgacttttagtgaatttttcctgctaggctaggaatcatataactagtg

Exon 13 +      74240      74346   0   Internal    107   100   Excellent
aagtgattggttgactgattagataattttgctattcctttcacgaataaattgtaaaca
aagctatgtataattatcatatttataaaatttttaggatatttaaactctagagtggaa
ctttaaaaattacagacacaaaaagaaaataaatttagaaaaattattgttttattttag
GTGATGTTCACAGAAGAAGATGTCAAATTCTACTTGGCTGAACTTGCACTTGCTTTAGAC
CATCTACATAGCCTGGGAATAATTTATAGAGACTTAAAACCAGAAAA
gtaaggaatcatgctactaagttgaatacaatgtaatatgattgtttaggagattataaa
aaatcaagtggcttcatgaaactcccacagtattgcactagcgtgcctgtgcttcacatc
tctgctaacactgtagtttcatactttaaaaatctcagttaatcaaaaaatactgttttt

Exon 14 +      76655      76795   0    Initial    141    48    Marginal
attctactataaagacacatgcacacgtatgtttattgcagcactattcacaatagcaaa
gacttggaaccaacccaaatgcccatcaatgatagactggataaagaaaatgtggcacat
atacaccatggaatactgtgcagctataaaaaatgctgagttcatgtcctttgcagggac
ATGGATGAAGCTGGAAACCATCATTCTCAGCGAACTAACACAGGAACAGAAAATCAAACA
CTGCATGTTCTCACTCATAAGTGGGAGTTGAACAATGAGAACACATGGACACAGGGAGGG
GAACACCACACACCGGGGCCT
gtcaggagttagggggctaggggagggatagcattaggagaaatgcctaatgtaaatgac
gggttaatgggcgcagcaaaccaccatggcatgtgtatacctatgtaacaaacctgcacg
ttctgcacatgtatcctagaacctaaagcataataaaaaaaaaaaaaagttagtacaaaa

Exon 15 +      79299      79336   2   Internal     38    63    Marginal
tgttataaatgtgtgtccaaaaaataatttgttcctcctttgcctttgccatcttattca
cagtctaaagcaatgttttagagtaaatgtggtgatctgatgcttaaggatgtaatttca
gtcttagcttctataaatctctatttagtgttcttaaaagattttctttgtttttttcag
TATACTTCTTGATGAAGAAGGTCACATCAAGTTAACAG
gtaaaaaaaaaatcctcgttttattaaaatattttctcctacaatatatactttccttta
aggttgattgtggtacaaatattgagtaatacactgtattaaaattaaaaacttgtatta
gggccaggcgtagtggctcacccctgtaatcccagcattctgggaggctgaggcaggtgg

Exon 16 +      79844      80005   0    Initial    162    57    Marginal
cccgggaggcagaggatacagtgagccaagatggcgtcactgtactccagcctgggtgac
agagcgagactctgtctcaaaaaacaaacaaacaaaaaaaacttgtattagaaattttaa
atgattaatgtcagaactcaaagtttaaaatttacatgtgcaaatttatgtaggatattt
ATGATATTTGTTTTGGCAGATTTCGGCCTAAGTAAAGAGTCTATTGACCATGAAAAGAAG
GCATATTCTTTTTGTGGAACTGTGGAGTATATGGCTCCAGAAGTAGTTAATCGTCGAGGT
CATACTCAGAGTGCTGACTGGTGGTCTTTTGGTGTGTTAATG
gtaaggtttgaatttgggattttttagaggggaaggagattgttaagtgaggatcagcag
tgaatgttaaagaaactggtgtttttattttctttattttatgccatatgtaataaataa
ccaagaaacattattgcatgcagtatagaaggactatgaaatctgttagctgcgtctatc

Exon 17 +      81467      81537   0   Internal     71    78        Good
tgttttaggaattatcaagaacttcagtaacgaatatggtagaaatagaaaacacttgtt
atgtagcaattttagaatatttggttataattaaaatgatgcttttttttttttttacct
tctggccttcagattttatatttattgactaacacttctgattattttgcctttctgtag
TTTGAAATGCTTACTGGTACACTCCCTTTCCAAGGAAAAGATCGAAAAGAAACAATGACT
ATGATTCTTAA
gtaagtactcccttaatatagatgttttgatgagattttaaaataaatgcttcaggctgg
gcgctgtggctcatgcctgtaatcccagcactttgggagggcaaggaagacggatcactt
gagatcaggagtttgagaccagcctggccaacatggtgaaaccccatctctactaaaaat

Exon 18 +      85810      85980   0     Single    171    42    Marginal
ggaagtggttacactggatgaggggttctggcaatgttatgtgtcttggccagataacta
ttcagtttgtggtaaataattgagctgtgtactttgggtgtttttgttcggggttttttg
gggcattttatattattctacacaatataaaaggtctaaaaagatgtgctacataaatga
ATGTTCACTGAACTTTCATCACTGAACCTTTATCACTTCATCTACTTTGATCCCTCCCTT
TCAGCGAACAAACACTCTCGTGTTGAAGAAACTAAATCCTTCTTTGACTTGGCCTTCCTT
TCAAGTTACTGTACCATCTTCCTGCATCCTTTCAACACAAAGCCTCTTTAA
aaagtagtctatgctttctgttactacttttttggcttcttttattccacagcctatttg
tcattcatccccaccactctactgaaactgctctctctgtggctatcagtgatcttctgg
ttgctaaaaccagtggcaggttgtcaaaaggatgactctaccattcattcacacaattca

Exon 19 +      91335      91399   1   Internal     65   100   Excellent
ttgaggctgcagtgaactgagatcacaccactgcgctccagcctgggtgacagagcaagc
ccttgtctcaaaattaattaattaattaattaattaattagacaagtattgaaaacaaag
gctgagcaatatgtatatttctccttgaaataaaattatcagtgaatccatttttgatag
GTGCAGGACCAGATGGAGTTGAAGAAATTAAAAGACATTCATTTTTCTCAACGATAGACT
GGAAT
gtaagtatagaatgaaaacttgcttgaaatatttctttataattaaaatatgtctaagtc
tcttttttttttcccctccagaaactgtatagaagagaaattcatccgccatttaaacct
gcaacgggcaggcctgaagatacattctattttgatcctgagtttactgcaaaaactccc

Exon 20 +      91481      91583   0   Internal    103   100   Excellent
gaaataaaattatcagtgaatccatttttgataggtgcaggaccagatggagttgaagaa
attaaaagacattcatttttctcaacgatagactggaatgtaagtatagaatgaaaactt
gcttgaaatatttctttataattaaaatatgtctaagtctcttttttttttcccctccag
AAACTGTATAGAAGAGAAATTCATCCGCCATTTAAACCTGCAACGGGCAGGCCTGAAGAT
ACATTCTATTTTGATCCTGAGTTTACTGCAAAAACTCCCAAAG
gtaaggagaaaatgtgaaaatccaaatataagacaacaaatatgtttttttcttgtttca
tcagaaaatcttttccagactctgggcgcggtggctcacacttgtaatcccagcactttg
ggaggctgaggcgagcagatcgcttgaggccaggagttggagaccagcttggccaacata

Exon 21 +      92545      92669   1   Internal    125   100   Excellent
caatacacaatcagaacagatctgatacagtgcctcacaggtatcctggaaagcaagagg
tatatactgtgtacctgagaaatagaattccagaataagtgaaaaaggtcatagtgtcaa
cagtttttcccttaatttcctttcaaatgaatcttctttgtcacttcttactcttttcag
ATTCACCTGGCATTCCACCTAGTGCTAATGCACATCAGCTTTTTCGGGGGTTTAGTTTTG
TTGCTATTACCTCAGATGATGAAAGCCAAGCTATGCAGACAGTTGGTGTACATTCAATTG
TTCAG
gtgagtggatgtctaaataattttagatttggaatgttgtaagatatagttcattctgtg
aatagatctttttctactgacttcaagtgagcaatttaaaatacattttagactgggcat
agtggctcacacccgtaatcccagcactttgggaggccaaggcagttggatcacttgagg

Exon 22 +      94962      95087   0   Internal    126    88        Good
tcattgtaaacactttcaaaatcacttgtttgtagaataataagtactataaagatgtat
ttttattcttattcatttatatgtagggcatcaacaatgcatgctgagtaacatacttcc
ctattataaaatgcactaaaggcattatgggactcttcaccaatttataattttttgtag
CAGTTACACAGGAACAGTATTCAGTTTACTGATGGATATGAAGTAAAAGAAGATATTGGA
GTTGGCTCCTACTCTGTTTGCAAGAGATGTATACATAAAGCTACAAACATGGAGTTTGCA
GTGAAG
gtaaattttttttatttaaaatgcaattcatacagttcttgttcatgcatgtcagtacca
gttaaaaattacactccccttgttgttaaaagtgccttttgttataaaaaagttaaatat
ctggctagtgatcttcagagatcttaatctagaaccctgtgagctaaaggtaaggtggtt

Exon 23 +      98342      98431   0   Internal     90   100   Excellent
ctatatcaagactggctttctgattaaacaatctggccaggtagttgaataaaactgact
gataaatggcttatttatacactatttacatgaggtaatacccaaggtctgtagctataa
acaattaatgtttataactgtatagttgatgaggttttgtgataaacatttgccttttag
ATTATTGATAAAAGCAAGAGAGACCCAACAGAAGAAATTGAAATTCTTCTTCGTTATGGA
CAGCATCCAAACATTATCACTCTAAAGGAT
gtaagtagattctttaatatggatcatttgaatcagttgtctaactcacattgaaagtag
tgtattttcaaaaatcatgtggtagacaaagaactcatcataggctgggcacagtggccc
acgcctgtaatcccagcagtttgggaggccaaggcaggaggatcacttgaggccaggagt

Exon 24 +     100086     100244   0   Internal    159   100   Excellent
tgcagtgagccaagattgtgccagtgcactcctgggcgacagagtctgtctcaaaataaa
taaataaataaaatttgtcttgaatatgaagtgagtttaatttttcctttatattttaaa
cttcgttttgggcacatatagtttcaaataatatttacattttgatgttgaaatttatag
GTATATGATGATGGAAAGTATGTGTATGTAGTAACAGAACTTATGAAAGGAGGTGAATTG
CTGGATAAAATTCTTAGACAAAAATTTTTCTCTGAACGAGAGGCCAGTGCTGTCCTGTTC
ACTATAACTAAAACCGTTGAATATCTTCACGCACAAGGG
gtaagtctttttaccactctatatgtacatacacacacttttttcctttatgtttgagct
agaattagatagaaattactttatgcctgaaatggaaaataactgctattagctgaatta
tcctactgaccttcctctatataaacttttattattgagattgaagtgtacctttgatat

Exon 25 +     102773     102934   0   Internal    162   100   Excellent
tgcccccggtctatgttagagagttatgctttacattatcagtattttataatgttaggc
taatttaaaggtcagcactcatcatcttgttaagtgcattgcttgacagtttgtgaataa
agaactttcagtaatggaaatatattgttaacataactctttaatttgtatttcaattag
GTGGTTCATAGAGACTTGAAACCTAGCAACATTCTTTATGTGGATGAATCTGGTAATCCG
GAATCTATTCGAATTTGTGATTTTGGCTTTGCAAAACAGCTGAGAGCGGAAAATGGTCTT
CTCATGACTCCTTGTTACACTGCAAATTTTGTTGCACCAGAG
gtaattgtgagagagtttgcttgcagtattagtatgttttaaaactcattcactatgttt
aataccgaattattaataataatttaattgaagacttactgaagaaataattaggataaa
atgccagcctttcatttccctgtttaatgtttcagtgacatctgattgcctacagaagaa

Exon 26 +     104793     104869   0   Internal     77    73        Good
tatgaattattagtagtagaatgttctagaatcggattaacgtattgccttatttggtaa
ccatgttctgttgaaattttccttataggtgttgatttggaatatataattcaactcata
gccttacaaatatatatacaaaatggtggtatagtaatactaattttgcactttttctag
GTTTTAAAAAGACAAGGCTATGATGCTGCTTGTGATATATGGAGTCTTGGTGTCCTACTC
TATACAATGCTTACCGG
gtgagtgtataccatatgttctaagcacctaagcatttgttcatcaatgttttgcttaag
ttatctaggtttttgttttgtttggggttttttgtttgtttgtttgctttttctttagag
acagggtctcactctgttgcccaggctggagtacagtgacacagccatagttcactatag

Exon 27 +     111584     111724   0   Internal    141    56    Marginal
atttagcagggaaaaagcggagactgattttttttcccccaaattaccatgttgaccaaa
gggctgctaccagaaaaagcagtatcacagaagctaaggaagaatgttcattagtatcaa
gagccatagaaaaagaagcaaaacaaaaggtttaagcttgttttattattcccattacag
GACCTGGTGTCAAAGATGCTTCATGTAGACCCTCATCAGAGACTGACTGCTGCTCTTGTG
CTCAGACATCCTTGGATCGTCCACTGGGACCAACTGCCACAATACCAACTAAACAGACAG
GATGCACCACATCTAGTAAAG
gtgagcagccccatacagtcactgttttccacaggtcctccaggagagacttcaagaagc
cctgtccatgcccccagcacctttctctttcatcctgcatccagttctgttgtgggattc
tcttacagtgggtgacttcgaaaagctcaaggcatatcaatatattagtaataaaactag

--------------------------------------------------------------------------------