--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6159 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1858       1960   0    Initial    103    88        Good
attaccaccttattggccgcctttctcagcttttctgtagttacccatattttgttcctc
tttcttgtctattttctgtgctttttctctgctttccgtctcgctattttctcacatctc
cattttctttctccttcctgccaccattcttcatgttcttcccacaggacttgaactgcc
ATGTCCTCTGAAGAAGGAAAGCTCTTCGTGGGAGGGCTCAACTTTAACACCGACGAGCAG
GCACTGGAAGACCACTTCAGCAGTTTCGGACCTATCTCTGAGG
gtgagacgggccatactcacaatgggggttggtgagagaaagtctgggatccttgcattt
caaggagtattaactgaaaagttaggacccacgcctccaaattctttttcttcctaagcc
tatggtgtagactaaggatgaggggaagcgtctttgggattagtgggagcgctccgtttt

Exon  2 +       2238       2344   1   Internal    107   100   Excellent
caaattctttttcttcctaagcctatggtgtagactaaggatgaggggaagcgtctttgg
gattagtgggagcgctccgttttccctacctatgccatctccttttccggccaccctttg
ctacttaacctttggggtactgactggtccacattgctccatcttctctccctctcacag
TGGTCGTTGTCAAGGACCGGGAGACTCAGCGGTCCAGGGGTTTTGGTTTCATCACCTTCA
CCAACCCAGAGCATGCTTCAGTTGCCATGAGAGCCATGAACGGAGAG
gtggggcctcctatctgcagagggaccttgtccccatctgcggcttccttcattcttttt
gtttttccctctgtgtctgctcggggcagcgtggccaccaagccccgcagtgcccactca
caggagcatgactgccttttgttctagggggtggagggcagcggcagacagagcctggcc

Exon  3 +       3022       3125   0    Initial    104    66    Marginal
taaaggagcttattctggaacatggcacccagaacctggtgcccagcaggaatttttggc
ctcttttgcccacttacccttgcctgctcttccctcaccattgccctgactgactgccaa
cccatcatccttgtgtctcccacacttagtctctggatggtcgtcagatccgtgtggatc
ATGCAGGCAAGTCTGCTCGGGGAACCAGAGGAGGTGGCTTTGGGGCCCATGGGCGTGGTC
GCAGCTACTCTAGAGGTGAGTGCAGTGATCGTTTTGATCATGGG
gtgagagggagagttgcctatgtgtggacaactgccatttaaatatttttctgctctagg
tggtggggaccagggctatgggagtggcaggtattatgacagtcgacctggagggtatgg
atatggatatggacgttccagagactataatggcaggtgggtagccaaagggctgggatg

Exon  4 +       3185       3281   1   Internal     97    97   Excellent
tcagatccgtgtggatcatgcaggcaagtctgctcggggaaccagaggaggtggctttgg
ggcccatgggcgtggtcgcagctactctagaggtgagtgcagtgatcgttttgatcatgg
ggtgagagggagagttgcctatgtgtggacaactgccatttaaatatttttctgctctag
GTGGTGGGGACCAGGGCTATGGGAGTGGCAGGTATTATGACAGTCGACCTGGAGGGTATG
GATATGGATATGGACGTTCCAGAGACTATAATGGCAG
gtgggtagccaaagggctgggatgttctcctattgcttccctctccttaagaactcagcg
cctgggtgttcatgcataccacaccttgctgttactaatgtgtacctaaaatgagtatga
aatttagcattttaagttaattgtgtagtcatatagttgcgacatggtaaagtatactat

Exon  5 +       3703       3763   2   Terminal     61    85        Good
actgcgtataaatcgtatgccataaaactgtttactgtgatactcatatgcttaacatat
cctgtttttgatacgtaaggtttatgttatgacccatactgtaaaatgtgacgcatataa
ttacagtggtatatataatgcagtaccagaaaacttttgtgtgttttttttcccccccag
AAACCAGGGTGGTTATGACCGCTACTCAGGAGGAAATTACAGAGACAATTATGACAACTG
A
aatgagacatgcacataatataggtgagacttggatatcggcattgagtgaacctgtttg
tcacactctgtcatgaccctctcaccttttctggcaagactgctctgcatttctgctgcc
ctcatacctcacccagccaacctaccaaacattcctagctaggccttccttgctctcagg

--------------------------------------------------------------------------------