--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28080 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        218        251   2   Internal     34    75        Good
ccgggggtgcttttgcaagaggagcctctcccggagctggacgtacacttcggttccctt
tgcacgcaggcaccttggtcgcctcccccaactccgtcccctctgctcctggccctcatt
ttcttctatttcccttttggccttgcagccagctttctcctcccccgacacactcctcag
GGGCTATGAAGTTCCTGAGCAGAGCAGGGCTCAG
gtaagcaggcccagggtagttcagccctgctctctccagctccgccagcttggggtgggg
tcgcgctgggacccctgcaggtgacaaaaatgactcagcaggggccggggctgggatgag
aaaggaacgccagtgcagggacaaaatcccctgaagcgcgaagaggccgcaaaccatcat

Exon  2 +       2281       2459   0   Internal    179    94   Excellent
tggtgtacgcagggggtattgatctcaatggaaaaaataggcttcctgattgttagtatt
ttctccaccttctggaagagcagttagttgtccgtgtccaaattagaggtaaaaggaaag
agtacatgaggtgtggccatcttgaggtgacctccaatttctgactttgatctatctcag
CCACTTAATCGTGTGGGCTTTCTCCAAATTTCAGTGTTTGAAGATACTGTGGAGGAGCGT
GTCATCAATGAAGAATATAAAATCTGGAAGAAGAATACACCGTTTCTATATGACCTGGTT
ATGACCCATGCTCTTCAGTGGCCCAGTCTTACCGTTCAGTGGCTTCCTGAAGTGACTAA
gtaagggtttctggcaacttttattttgtttaaatttaactgtcgttctgaatttcctag
ttttggcgttttatgcatagaacataagtatgtaatcagcccttgcatgaggtggcaggt
ggtttttattttcaaaacttacgtgatttgtgggatgatttctggtgtatagtgtggtgg

Exon  3 +       7571       7759   0   Internal    189    87        Good
atgtgcacacacttttttaccgtaagccaaattttggtaaaattgcatcttgtattttct
tattactaaattacttgcctagaagtaatcttcaatctttttagaaaaaaaaaaaaaatt
gaatcctttgtgcagctgaaatttagaaacagataaatggcctaacttgtcttgtgttag
GGCCTAGACCCCTACTTCTCAGTCCTCTTCATTGAAGTGGGACCATGGAGCACAGTTGAA
AATTGTATTCTAGATAATACAAATGGGAAAGCCTTTTTAATAGATACTGATGCAAAAATC
ACTGCTCGGACCAAGGTGCCAAGAGGTTTGGGCAAGTTCTTCAGCCTCAAGGTGTTTCCA
CAGAACAAG
gtaacaaagatacctcggtaaaattgagaatgttcgtttcataaacttaggtatcataaa
cgtcagtgagtttcacatcatgccatttgcacttatagcctattttattcagtgaagaaa
ctgaggccccagggaggttgtgttttaagcaactgcattttagtttgatccaggatttaa

Exon  4 +       8435       8580   2   Internal    146    86        Good
ttatatttgcatatgtggggattgtaaagttggtaaccagagggggagaagatacacagt
tgatgctaagtatatatttgctaaagaaatatgaatgtattttgagggaactagactgaa
tttgttagcaattggagatttcttgtaggattagtgtgacttattttctttcttaaacag
ACCTGAAGGAAAAGATTATGCCCTTCATTGGCTAGTGCTGGGGACTCATACGTCTGATGA
GCAGAATCATCTGGTGGTTGCTCGAGTACATATTCCCAATGATGATGCACAGTTTGATGC
TTCCCATTGTGACAGTGACAAGGGTG
gtaggtatatcatatattccaatattggtgtcaaagggaaaatgtctctttcaaagcata
tgctattaaaactatactattagcttttggcccagtaatttaacttctaggactttattc
tacagaacttcccacccacatgtgcacaaggattttagtcgtaattgcagaattgaaaaa

Exon  5 +      12686      12859   1   Internal    174    99   Excellent
ataaattgatgtggcaaatgaacccacatttttgggttttctctatgcatgtttctgtct
ttgtcttgtcagtttgtgttgtattctgccaggtcaaaatctgttaggttgattgaacta
agtgatttgtgaattttaatcctgagtgtgtgtgtgtgtgtttctttctcctcacattag
AATTTGGTGGCTTTGGTTCTGTAACAGGAAAAATTGAATGTGAAATTAAAATCAATCACG
AAGGAGAAGTAAACCGTGCTCGTTACATGCCGCAGAATCCTCACATCATTGCTACAAAAA
CACCATCTTCTGATGTGTTGGTTTTTGACTATACAAAACACCCTGCTAAACCAG
gtatgtaataatagagttaggtcattacttgagcagttttcttgattcaaactggtaatg
tttttaaggtcaaagtagcatactttataatatttaaaggtttaaaaattgctttggggg
tcccataaccatcctcaagttcagggatttgccagaactacctaaaagcagcttatacta

Exon  6 +      13826      13941   1   Internal    116    94   Excellent
taggttttccaaagaaaccaatcatctaatggtcatgaggctcaatttgcattgggtatt
aaagaccagatctcgttcgtgtgcagttgctgtaatggttcactcaatgaaggagtgaga
atttattctcaccagttctgataaacagagaataacttaatgtttttcatcttttcttag
ACCCAAGTGGAGAATGTAATCCTGATCTCAGATTAAGAGGTCACCAGAAGGAAGGCTATG
GTCTCTCCTGGAATTCAAATTTGAGTGGACATCTCCTAAGTGCATCTGATGACCAT
gtgagaaacgtattctttgtaatttgttcatatagtgagagctgacgtgtcacagctgtg
ctgaaggagtactatatagatgaaaggttttctaagataatactgctgattattgtggta
acattcccccaggactttagagagatggttttcatactgccctgtatgagtcttcggatt

Exon  7 +      17693      17853   0   Internal    161   100   Excellent
ctgtaatcccagctcaggaggctgaggcaggagaatcgcttgagccctggaggcggaggc
tgcagtgagccgagatcgcaccagcctgggtgacagactgagacactgtctcgagggaaa
aaaaaaaaaatcagtctcttatagcccttgttcttttttttttctctccttctctcttag
ACTGTTTGTCTGTGGGATATAAACGCAGGACCAAAAGAAGGCAAAATTGTGGATGCTAAA
GCCATCTTTACTGGCCACTCAGCTGTTGTAGAGGATGTGGCCTGGCACCTGCTGCACGAG
TCATTGTTTGGATCTGTTGCTGATGATCAGAAACTTATGAT
gtaaggtggaaaattcagtgggatcttgttaaatgggtgacctgaatgaccatcagtgat
tgctgcaggctgtagtttgattttttttttttaagttatggctttaaaaaacagctttag
gtagcttactcctgtaatctcaataccttgggaagctgaggcaggaggattgcttgagac

Exon  8 +      18488      18610   0   Internal    123    52    Marginal
agaaatacctgaggcaaatgtgacaaaatactgggcatttgtcaaaactagttttaggta
tcagattgtgacattattctctacatagtctgtattttgtgtacacttgaaatagttggt
aattaaaataggaatctaatttaaaaaacaggactaacagccctagcttgttctctgtag
GTTTCGAATGTATCATTTAGTGGTCGAGGTCTGAATCACCAGCTGTGTGGTTGGTTTCTT
CATGAAGGGGAGCACATAGTGGAGCTAGTTGTGGAGTGCAGTGACAGTGATGTGAGGCCG
AAT
gtgagtgtgtcatccctgggtgccgtgtgcctttacctttgtgttttagatgggacacca
ggtccaataccacctccaagccgagtcacttggtggatgcgcacactgccgaagtcaact
gcctctcattcaatccctacagcgaatttattctagccaccggctctgcggataaggttt

Exon  9 +      18660      18786   2   Internal    127    91   Excellent
ctctgtaggtttcgaatgtatcatttagtggtcgaggtctgaatcaccagctgtgtggtt
ggtttcttcatgaaggggagcacatagtggagctagttgtggagtgcagtgacagtgatg
tgaggccgaatgtgagtgtgtcatccctgggtgccgtgtgcctttacctttgtgttttag
ATGGGACACCAGGTCCAATACCACCTCCAAGCCGAGTCACTTGGTGGATGCGCACACTGC
CGAAGTCAACTGCCTCTCATTCAATCCCTACAGCGAATTTATTCTAGCCACCGGCTCTGC
GGATAAG
gtttcgaagtttttgcattatttggtgtttataaaacccagttctcttgtgccttaatca
gatatttgaaaattcttaggtaaagcatagaaatcattttcacttgttatttttctttag
accgtagctttatgggatctgcgtaacttaaaattaaaactccataccttcgaatctcat

Exon 10 +      18907      19088   0   Internal    182    98   Excellent
aactgcctctcattcaatccctacagcgaatttattctagccaccggctctgcggataag
gtttcgaagtttttgcattatttggtgtttataaaacccagttctcttgtgccttaatca
gatatttgaaaattcttaggtaaagcatagaaatcattttcacttgttatttttctttag
ACCGTAGCTTTATGGGATCTGCGTAACTTAAAATTAAAACTCCATACCTTCGAATCTCAT
AAAGATGAAATTTTCCAGGTATGTGACAGTTTTCTGGTGTCTGTATGTCAGGAAATGAAA
TCCAGGGATTCATCAGTTAAGCTATACCAGACTCGTGGGTCCACTATTGAAAAAAATGTC
TT
gtacgtggtgttacatggagatgctcatagggtaaggtacaccttgttgaagaattaaaa
agcttctgggatggttatggggtcgaataaatttattgagatcccaggctgagttcctca
gtgctggggagtgcagccttcctgaggacaggatggagctgagcccttgcagagcacttg

Exon 11 +      22175      22291   2   Internal    117    73        Good
aggctgtagtgcacagtgatcgtgcctgtgaatgaatagctactgactgcagcctgggaa
acatagcgaggccatgtctctaaggaaaaaaaaaacctaattgattgtagtatagaaata
agttgtttttgtgagtgtgtttatgttttaagattactttctgggctgatactggtttag
CAGATGTTCGTGCTACAAGAATTTCACTGATGAAAGCGTTATATTCTTTATTCTTACAGT
AAAATTGGGGAAGAACAATCAGCAGAAGATGCAGAAGATGGGCCTCCAGAACTCCTG
gtacgcattggcttatagaagatgaaatgtcatatgcagattggattgtcattgatctct
ttatttcgagaatgggtcagaacttcgaattctagctcttgcagatggtttcaaaatgga
ggccctgaaggttattgcaactgggctttgacatttatcaaaaatagtaaatggagccca

Exon 12 +      26432      26591   2   Internal    160    93   Excellent
attacacactggcaaagaatttttcaaaatactggctagcctaccatttccttattgaag
tttttaagagagaaatgtaaaaatgaaactattaagttctaaatagattaaattgttttt
acatgaccatgtgaaaaccatagggagtttttacctgtgaatttatttggttatctccag
GCTGAAAATATTTACAATGATGAAGAGTCAGATGTCACGACATCCGAACTGGAGGGACAA
GGATCTTAAACCCAAAGTACGAGAAATGTTTCTGTTGAATGTAATGCTACATGAATGCTT
GATTTATCAAGCGCCAAAAAGGCATTGTATAGTAGGAAAT
gtaagtggggtggcttatggcttctttatcctctgattctagcactttcaagtgagctgt
tgcgtactgtatcatattgtagctattagggaagagaagaatgttgcttaagaaagaaca
tcaccattgattttaaatacaagtagcagggtattgcctttgattcaactgttttaagtc

--------------------------------------------------------------------------------