--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7283 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1458       1524   0    Initial     67   100   Excellent
acctcttacatcttttagtgcgtatgttctgtccacccagctactggttcatttgagtag
atcggagtcagatgagtacatgtttacgggaggcgcttggttacgggatccagataggaa
tctttatctgagctgcttgtcagtttgttcgtctgtccctaggtctgtctgctatcagct
ATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTG
GAGCCTG
gtgagacagctaaaagcagatggtcctaacacgtgccagcctcgacaggcacttttgttg
ttgatactgacgcttgatacctagcatgggccaactgtgcaccaagcaatggggtggcag
gcatttttcgttgttaacaatgtggattcctgacatccatccctaccgcgtgtcaagtgg

Exon  2 +       4132       4243   1   Internal    112   100   Excellent
cctaatatagagagttggatttggaatgtgaaagatacttcatattcttcccggcacaca
cacacacgtgtcttttatgtgtggcttgtgtgaatgtgagtgcgtgtctctaggctctac
atgtaggatgaggtcccctggtccttatctgctctcctcatccccaccttgttctaccag
AACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTACGAGGCCA
CCAGGTTGGAGGGCCTACCACCAAGCTGGTACAAGGTGTTCGACCCTTCCTG
gtgagcctgggtgagggggagctaacttctggcttcacccttcctgtgctgaccttggtt
gtgaggtttagggggacacaagggagggagcctcgggtggagggtgttggcattaggtat
ctgcaggactcaagttgctgcctgctggggcctggctcctctggggttggaagactgtct

Exon  3 +       4872       4984   2   Internal    113    58    Marginal
attacaggcatgagccaccacgcccagctgacagtgttttctcttcaggagaagagattc
tggggatcctgcctgtggggtcctgacatggggcaggtataggcagagactggggagaca
agagttgaggatccaaggcaaggacatctgtgctgacacttctttcctgcggccccacag
CGGGCTCCCTTACTACTGGAATGCAGACACAGACCTTGTATCCTGGCTCTCCCCACATGA
CCCCAACTCCGTGGTTACCAAATCGGCCAAGAAGCTCAGAAGCAGTAATGCAG
gtgagttggcaggtacaagcgtgccttgagtgatcttagcagttctcacggagaggccaa
gtagaatgatagtggatcagaggggcaggtgagaccaggcgggcccagcctcaggcaagg
gaggttgttgaaggcagaggctgctgggtcctggggtggcaagaggtcacttcaagactt

Exon  4 +       5175       5513   1   Internal    339    99   Excellent
aggtacaagcgtgccttgagtgatcttagcagttctcacggagaggccaagtagaatgat
agtggatcagaggggcaggtgagaccaggcgggcccagcctcaggcaagggaggttgttg
aaggcagaggctgctgggtcctggggtggcaagaggtcacttcaagacttgtgtccccag
ATGCTGAAGAAAAGTTGGACCGGAGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGG
ACCGCAGCCATGAGAAACTAGACAGGGGCCACGACAAGTCAGACCGGGGCCACGACAAGT
CTGACAGGGATCGAGAGCGTGGCTATGACAAGGTAGACAGAGAGAGAGAGCGAGACAGGG
AACGGGATCGGGACCGCGGGTATGACAAGGCAGACCGGGAAGAGGGCAAAGAACGGCGCC
ACCATCGCCGGGAGGAGCTGGCTCCCTATCCCAAGAGCAAGAAGGGTAAGCTGGGCAGAA
TGGGGCTCGGTGAGACCAACAAGGTGCAGGGTGCACTGC
gtgaggaagccttccctcaaaaagatgcctggacctggggctagaggagggtgctgtggt
acatggcagccaggggcttcatttcttcttgtggggtggggctcagtgatcaggggctcc
tggtgcctctattgaagactttgccctgccacttccacagcagtaagccgaaaggatgaa

Exon  5 +       5870       6026   2   Terminal    157    82        Good
tgaagagttagaccccatggaccctagctcatactcagacgccccccggtaagtgacaac
ccctcttgactcagtacgtggacaccatcctccggcctccttcctccattcctcattggg
accaggtgggctgtgtccgccacatcacccatccccatcccctgactctttcaccggcag
GGGCACGTGGTCAACAGGACTCCCCAAGCGGAATGAGGCCAAGACTGGCGCTGACACCAC
AGCAGCTGGGCCCCTCTTCCAGCAGCGGCCGTATCCATCCCCAGGGGCTGTGCTCCGGGC
CAATGCAGAGGCCTCCCGAACCAAGCAGCAGGATTGA
agcttcggcctccctggccctgggttaaaataaaagctttctggtgatcctgcccaccat
acctgagtgcttcctttgaggctgcccaacccaagtcggcaagatacacaacacatttta
tttgcaaaaactcagctaagagatagtgtggagctggcaggggctggggggctgagctga

--------------------------------------------------------------------------------