--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (18465 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5193       5508   0    Initial    316    70        Good
tatggaaatcgaaaaggcatccgttacctcaccagtggcctcaaagtctattacttgcct
ctgaaagtcatgtacaaccagtctacagccacgaccctctttcacagtctgccattgctc
aggtacatatttgttcgggagagagtcacgataatccattcacatagttctttttctgct
ATGGCCCATGATGCTCTCTTCCACGCCAAGACAATGGGGCTTCAGACAGTCTTCACGGAC
CATTCCCTTTTTGGATTTGCTGATGTCAGCTCGGTGCTTACAAACAAGCTTCTAACCGTG
TCTCTTTGTGATACAAACCACATCATTTGTGTGTCTTATACTAGTAAGGAAAATACTGTA
CTAAGAGCAGCACTGAATCCTGAAATAGTGTCCGTCATTCCTAATGCTGTAGATCCTACT
GACTTCACTCCAGACCCATTTAGAAGGCATGATAGTATAACTATTGTTGTTGTCAGCAGA
CTTGTTTACAGAAAAG
gtaatgaaatgatagctataattgcattgtagacttttttccctatagaaagctgttgaa
tacttgtatataatgattgtttggcttttcattttgttttatggttttataatgctataa
attatagcaaagaaagttctaatattggtttatatatccaagaagagcgatttttcagga

Exon  2 +       8187       8230   0   Internal     44    61    Marginal
gtgatggtatggcctttcctgtactcaattcagtaattgaacagttatttatcgaaccct
ctccagatgccaggcaccctgcagaaagtaacattctgaaaaggaacagccatgcctgta
gcccaaaagtgagtagttgtattaatggtccattccttattaacaaattaatttcctcag
GAGTTTATTGGACCAGATATCAAAGTCCCACTGGAATGTCTTAA
gtgagagagaggataaatcaaagttttccttatccaggctttttggatgtctttttcctg
agcctcctcttccaagcctgttttgctctcagtcaggatttaccagcactctgcatgtgt
aggcacgctcacctgcttccttctgtagtggtaatgacaacctacatttgtattctgcag

Exon  3 +      10678      10810   1   Internal    133    82        Good
tcttgggggaccactgccagtttgcaaacaattccactcctggaaaaggtttaagagagt
ttctctcctttatggagtgcatagctaatacttttcaaaataagtggattctcagtcgtt
ctggtgaatttttttaagtttaaatattaatatctccaacattcaactttatattttcag
GGATCGATTTGCTTAGTGGTATAATACCTGAACTCTGTCAGAAATATCCAGATTTAAATT
TCATAATTGGAGGAGAGGGACCAAAGAGAATCATTTTGGAAGAAGTTCGGGAAAGATACC
AGCTGCATGACAG
gtattgatgaatttcatgttgtcttgagggagaagatgtcaattatctctatttggtttt
aactgcatgcgtaccttaggtgtgttgcttctcctgcatgtaattgatatacatataatt
gatataaatctaatgcaaggactgttttcaaaatttttatataaataggaaacctagtta

Exon  4 +      11572      11704   2   Internal    133    93   Excellent
aactgctttataaggctgtttctattagatcagtgtttggtgatactaatcttgaggtgg
agaacattagcagcaataagaatttaagtgtaatataaatagcagacttggtttataaat
taaatttcttttgtagcatgagttttcactcctttcttcccctctcatttaaaaaatcag
GGTGCGTCTTTTGGGAGCTTTAGAACACAAGGATGTTAGAAATGTCTTAGTTCAAGGACA
TATTTTTCTGAATACCTCCCTTACTGAAGCATTCTGCATGGCGATCGTGGAAGCAGCCAG
TTGTGGTTTACAG
gtaaaaagctttgagggcattcatggttgggatttctgtgtattttgaaaaataatgaga
cacattccataataatgttttaactggttttgttgatcttcctgaggtatgattatggtg
gagtatgtgttctttctttctttttaaggttgtaagtaccagagttggtggaattcctga

Exon  5 +      13876      13914   0   Terminal     39    63    Marginal
ttgtcatcgctaacattctcttcataatagtaaattgttattttatcacttaaaactata
agtagattaattgacctgaaataaagctggacaaaaaagtcagtttgtagttactctttt
aaccctatgacattttaattcatttcaactcctccttcttagtttaactgtgctatttag
GAAATCGATCATGAAATTAATTTGGAGTTCATGCTGTAA
acatacttcttcaattgcaattcaccagtctcagcataattctcaacataattctgatta
aaatgtttgtattcagaatgtcctcagggtaaaagagctcgatgaaaacatgccgtacct
ttcaagggctgttgacctgtacaacatgcactgcatgttataacttccttgagttcaaaa

Exon  6 +      14498      14656   0   Terminal    159    45    Marginal
actgaaatttcccccatctctttatcttcttttatttgaaatccatgaaatgcttctgca
tgtcctcaccatccatgctcagcaacatgtacagcctcatgtggctgttgaaagaggagg
ctctgtgttcccagaagtatgctagattgtagctctctgcttgtggttgatgtctgccag
ATGCCGGTGAGAGCATCTCAGCTTAGTCAAGGAATCTTCAAAGGCAAATCCTGCTTCAGT
ACTGCTGAAGTCACTGCTGAATTAAATATTGACCCTACAGTGGTGACCCCAAAAGCTGTT
CAGACTTTGCGGGACTTTGGAATTCTAGTAGTTGGCTAA
aattgatggtgactccctaggggagaggaactgtggcttattctttgtatcacacagcct
ctagcccggtgtcttgcccagaataagtacccaataagttttgaatcaaatggcaataat
tatcgtgattaagttcattaaggatatcattactatgacaacaacaacaaaacacaagca

Exon  7 +      14952      15218   0   Terminal    267    81        Good
ataattatcgtgattaagttcattaaggatatcattactatgacaacaacaacaaaacac
aagcaacttttgtttgtatttgtttataaaatgttcctgcaggatcgggtcattgtttat
catgggacaggtgatggggtgatgggtgaaagtgctcacacttggcttctctccctccag
GTATATGACCGGGTATCAGTGGAAGCTGTGTTGCCAATGGACAAACGACTGGACAGACTT
ATTTCTCACTGCGGCCCAGTAACAGGCTACATCTTTGCTTTGTTGGCAGTTTTCAACTTC
CTCTTCCTCATTTTCTTGAGATGGATGACTCCAGATTCTATCATTGATGTTGCAATAGAT
GCCACTGGGCCACGGGGTGCCTGGACTAATAACTATTCTCACAGTAAAAGAGGGGGTGAG
AATAATGAGATATCTGAAACCAGGTAG
aaggaagcctagattgtaagattttaaacatttgtaatagttctataaagactatggaaa
ataaccttgcttttggggggtttttgtttttttagagttaatttagtaagttatgctacc
tctatatcattcaatattttctgttgaggaaagataaaaatgtatgcaattcctgagtgt

--------------------------------------------------------------------------------