--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (105092 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (36 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        637        773   2   Internal    137    99   Excellent
ctctatggccttgggtcactggccacagtaccattattcataagttgaaataggactgtt
tgtttttaaggcttcttctgactctcaaatactctgcttttatggctccttgcttggatt
ccacccttccagactagatttcctttaatagtgtaaatgttctgtttctccctacggcag
GGGCATCCTCCGTGTTCTGGGCCTAATGAAAATGGACATGGTGAACTATACCATCCAGAG
CTTTCGACCCTACCTGCAGGAACATTCCATCCAGTATGAACAAGCTAAATTCCAGGAACT
CCTTGATAAACAGCCCA
gtatgtttaaaattcaagggcaggagaggggagatttgacctcaggtctgccttcttata
gcaatagaggctattttctattttttgaatagaaagtttcttccttgggcaaggggtagg
gagaaggaatgtttctctaagatagaaagatctacaaaatcacttctttatagaccaaga

Exon  2 +       1348       1520   0    Initial    173    87        Good
tccaacaatggtgctataccaaggctacctgaacctcctcctctgggatcttgaaaacgt
agaattcccagaggtagggatgtgtgtttgggcattgccttgttctatggtattcagtgc
ctccattcaaaccctcctcttctgatgggctgtccttcgctccctcaccagactctgctg
ATGGACAGAATCCGGCTCCAGGAACTGGCATTCCAGTTGCACCAGTTAACTGTCCTGGCC
TCAGTCTTGCTAGTGGCCAGAAGCTTCTCTGGTGAAGTTTTATTCAGATCACCTGAATTT
GTGGATAGACTGAAATGCACCACCAAGGCCCTAACTGAGGAATTTATCTCCAG
gtaagattcatagatctctgttagagagggaaatgtgtggtatttgggacataggtaata
tcaatactattattgcttattcttcatcacaaaccacacaaaggcccttggaaatgatct
tcaaagattttggtatctttgataatttgtattgaggtttgggatacagaaaataaaact

Exon  3 +       2282       2487   2   Internal    206   100   Excellent
tggatcaggtggtaccttgcgggtaacaatgagtgtatttcatctgcccagtggctaatg
ctgtcttctggtggcagagagccagaattcttcctggaataggcctggcttgtggtatga
ggctctctgggctttgcccctctgccaggcccactctgcattctatcccttattatctag
GCCTGAAGAGACTATGCTGAGTGTGAGTGAACAGGTGTCTCAGGAAGTCCATCAAGGCCT
TAAGGACATGGGCCTCACTACTCTGAGCAGTGAAAACACAGCATCTCTTCTAGGCCAACT
CCAGAACATCACCAAGAAAGAGAACTGCATTCGTAGCATTGTTGGTAAGAATCTCCATGG
TCGTCGTGCAGAAAAGTGGCAAGAAT
gtggggcatgggtgggtagaccttaccctgaatgtgagttacctaagcatttaaaaatga
aaaggcatgatcatttgggaagttttttagctttagtttcctcgtctataatgtgcactg
ttcaaatagatctttctcaatttggagaatgcatgtatggtttgaagacagctctgtacc

Exon  4 +       3671       3853   0   Terminal    183    63    Marginal
ccaaatgagcagagaggtcagtgaataactcggttaatgcaaaactttggtgagcagata
gagcaaaggcattgtgaatttcttctgtaccgtcttcgttcctcttgtcattgtttttcc
ctgctcacagatcagtggatccgtttttttctcaaatgctgtttgcttcatggcatgcag
GAGTCTCTGCTACACTTTCCTGGAGGCCTCATTCTCATTGAAAAGGAGTTGGCAGAACTG
GGCTGGAAGTTTCTCAATCTGATGCATCATAATCAGCAGGTATTTGGCCCATACTATGCT
GAGATCCTAAAACACATCATCCATCCAGCTCAAGCACAAGAAACAGATGTGGAGCCTAAC
TGA
tagtgctggaccccagctatggcaacagggactcaggagagagaggtcagcatgtttctg
ggaggacatcacctgtggttagtcgaacagtcagccctcttcctcgctatagccaggaca
cagggatgcaggggtcaagcatgtaagcaccaactggcccaatccccttcactaataaac

Exon  5 +       6369       6399   0   Internal     31    97   Excellent
aaactatatccaggtttttgtgcatacttctaaagatattctgtgcatatgcaagtacat
attataattataacaaatatttgtgagtgtgtatgcaccaggcactcttttaagcactct
acatatattatttcaattattccttaacaatttatctccagtctacttttccaattctag
AACAATGTTGTACAGAAAGCTCTAACTGAGG
gtaagaaccggtgtttgtttgtttgtttatatatttatttatctggtcttctttgagtga
gtaagggaaaatcatttcactttcttgggctttgtcttcatctataaaattctatacttg
actaaattactgattttcttgttcaattttatagagtcatttttcacaaaacgaaatctt

Exon  6 +      19514      19613   0   Internal    100   100   Excellent
cagtgcttctcgggtattactcgagaaatttttgcccagaacagtatcctggagcgtttc
cccggtgttttcttgtagaagtttcataggctgacatctcagatttacgtctttaatcca
ttctgatttgatttttatataagatgagagataagggtcaagtttcattcttctccatag
GGATACCCAGTTTTCCCAGCACCAGCGCCATTTATTGAAGAGACTGTCCTTTTTCCAGTG
TATGTTCTTGGCACCTTTGTCAAAAATGAGTTCACTGTAG
gtgtgtggatttgttcctgggttgcctattctgtcccattggtctatgggtctgttttaa
tgtcagtaccttgctgatttggttactatagctctgtagtataatttgaagtcaggtaat
gtgattcctccagtgttgttcgtttttgctcaggatagctttggctattctgggcctttt

Exon  7 +      30159      30209   1   Internal     51    49    Marginal
taaaaatgtgtgctggcgtttttgcgactgaattaaatttatacaccaatttaggaagaa
ccgacatctttttaatgctggattattccatctaggacagtgacgtagtctgtttgggct
gctattacaaaataccatagactaggtagtttataaacaacagaaatttatttctcgcag
CTCTGGAGACTGACAAGTCCAAGATAAAGATTCTGGCTGATTTGGTGTCTG
gtgaggaccctcttcctcatcgatggtactttctaattgtatcctcaacatggtggaagg
gacaaggcagctctctgaagcctcttttatgagagaactaatcccattcataagggctcc
acccttatgacctagtcgcctctcaaaaggccccacctcctaatggcatcaccttgcggg

Exon  8 +      37586      37653   0    Initial     68    41    Marginal
gtcctgtagtttctggatctgggatgcactgatcacctggaagtaggtcaggcttgtttg
agtgaagtcagcacccttttggcacagaagatccaccaggacagacttagtctatctaaa
atccttttaaaatcctgtaaggggagaaacttctcaacttttttcactcatcatgagcag
ATGAACAACCTCCAGGAACTCAGCTTGTCTTGCTTCTGCCTCACAGATCAGCTGGACAAA
ATTTCCGG
gtgagaggttggggagggacctgggttccctgaatgccccattacgaacaaaagagtgcg
actattcttagatattcttaaacactttgtaacctatttctccttccacatcagcacggg
cactgctgggtgttttaaactggccaagctagagagtgtggtccctcatgctgaggagaa

Exon  9 +      38800      38878   2   Internal     79    71        Good
actgttgagtctgagtaacaatcagatatcctgggaagtttctgagccattccaggctct
gctggagacggtctcagggaccctgcagcatctggagatagacaactgcctgataactga
ttctactttctctgttgtcatcccagccctgagccactgttcccacctctgtgtccctag
CTTTGTCTTCAACCCCATTACAATGCCTGTGCTCACGAGTCTTCTGCAGCACTTAACAGC
GTTGATGGAGCTGAAGCAT
gtgatttatcctgtccctgtccattgctatgaacaatggcaatcacatggcagtttggac
atacaagcttgctaaagtgcaggcctcattgaaggtgatgctgcaggcagtaccacagaa
cgacatgaactagaccacccattctcagtgatcttcacaggacaaggagttgtttcatca

Exon 10 +      38907      39011   0     Single    105    72        Good
gcctgataactgattctactttctctgttgtcatcccagccctgagccactgttcccacc
tctgtgtccctagctttgtcttcaaccccattacaatgcctgtgctcacgagtcttctgc
agcacttaacagcgttgatggagctgaagcatgtgatttatcctgtccctgtccattgct
ATGAACAATGGCAATCACATGGCAGTTTGGACATACAAGCTTGCTAAAGTGCAGGCCTCA
TTGAAGGTGATGCTGCAGGCAGTACCACAGAACGACATGAACTAG
accacccattctcagtgatcttcacaggacaaggagttgtttcatcactgatgtgtggcc
actaaaatactgagtgttcttgcctgaagcccaatttgtaaagacacataatgtgccatt
ctgctattccaggaaactggtgttaggaagattggatatgtaactgacctccataaaaga

Exon 11 +      39144      39428   0   Terminal    285    46    Marginal
tcattgaaggtgatgctgcaggcagtaccacagaacgacatgaactagaccacccattct
cagtgatcttcacaggacaaggagttgtttcatcactgatgtgtggccactaaaatactg
agtgttcttgcctgaagcccaatttgtaaagacacataatgtgccattctgctattccag
GAAACTGGTGTTAGGAAGATTGGATATGTAACTGACCTCCATAAAAGAAAAACTCTAAGA
AGGAAACAGCAGACTTTACGAAGTCTTGTGGGTCTCTTGCCCATTGTCCTCTACGTCCTC
CTTCTTGTTACTGACCACAGTGTTGGGTACGTGACATGGGCTGACCCAGTCGTGGCACAC
CATTTCCCTGTCCACACTGATCGGTTCACTTATGGGTACTTGACGCAAGTCAGGACAGTT
GAAACCTTTCCTGGATGTTTTTCTGGAGTAGGTGCTGGTTACTGA
agccaataatattactcactgaggtcctttaatcttcctgtattcatgattgccttaggt
tgcttatgacaaaccattggcaattaaaatgaaaaacaagaacaacaagaaacaaactat
ccccactacctactggtgtctttatcagtatattgctatctcctttcctaggtctcagaa

Exon 12 +      42666      44006   0     Single   1341    89        Good
caaatgctgagggattttgtcaccaccaggcctgccctaacagagcttctgaaggaagca
ctaaacatggaaaggaacaaccggtaccagccactgcaaaaacatgccaaagtgtaaaga
ccatcgaggctaggaagaaactgcatcaactaacgagcaaaataaccagctaacatcata
ATGACAGGATCGGATTCACACATTACAATATTAACCTTAAATGTAAATGGGCTAAAGGCT
CCAATTAAAAGGCACAGACTGGCAAATTGGGTAAAGAGTCAAGACCCATCAGTGTGCTGT
ATTCAGGAAACCCGTCTCACGTGCAGAGACACACATAGGCTCAAAATAAAGGGATGGAGG
AAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCAATCCTAGTCTCTGAT
AAAACAGACTTTAAACCAACAAAGATCAAAAGAGACAAAGAAGGCCCTTACATAATGGTA
AAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATATATGCACCCAATGCAGGA
GCACCCAGATTCATAAAGCAAGTCCTTAGAGACCTACAAAGAGACTTAGACTCCCACAGA
ATAATAATGGGAGACTTTAACACCCCACTGTCAACATTGGACAGATCAATGAGACAGAAA
GTTCACAAGGATATCCAGGAATTGAACTCAGCTCTGCACCAAGTGGACCTAATAGACATG
TATAGAACTCTCCACCCGAAATCAACAGAATATACATTCTTTTCAGCACCACACCACACC
TATTCCAAAATTGACCACATAGTTGGAAGTAAAGCACTCCTCAGCAAATGTAAAAGAACA
GAAATTCTAACAAACTGTCTCTCAGACCACAGTGCAATCAAACTAGAACTCAGGATTAAG
AAACTCACTCAAAACCGCTCAACTACATGGAAACTGAACAACCTGCTCCTGAATGACTAC
TGGGTACATAAGGAAATGAAGGCAGAAATAAAGATGTTCTTTGAAACCAACGAGAACAAA
GACACAACATACCAGAATCTCTGGGACACATTCAAAGCAGTGCGTAGAGGGAAATTTATA
GCACTAAATGCCCACAAGAGAAAGCAGGAAAGATCTAAAATTGACACCCTAACATCACAA
TTAAGAGAACTAGAGAAGCAAGAGCAATCACATTCAAAAGCTAGCAGAAGGCAAGAAATA
ACTAAGATCAGAGCAGAACTGAAGGGGATAGAGACACAAAAAACCCTTCAAAAAATCAAT
GAATCCAGGAGCTGGTTTTTTGAAAAGATCAACAAAATTGATAGACCGCTAGCAAGACTA
ATAAAGAAGAAAAGAGAGAAGAATCAAATAGATGCAATAAAAAATGATAAAGGGGATATC
ACTACTGATCCCACAGAAATACAAACTACCATCAGAGAATACTATAAACACCTCTATGCA
AATAAACTTGTAAATCTAGAAGAAATGGATAAATTCCTCGACACATACACTCGCCCAAGA
CTAAACCTGGGAAGAAGTTGA
atatctgaatagaccaataacaggctctgaaagtgaggcaataattaatagcttaccaaa
caaaaaaagtccaggaccagatggattcacgcccccgaattctaccagaggtagaaggag
gagctggtaccattccttctgaaactattccaagcaatagaaaaagagggaatcctccct

Exon 13 +      45111      45884   0     Single    774    92   Excellent
agtgaactcccactcacagttgcttcaaagagaataaaatacctaggaatccaatttaca
aggaacgtgaaggacctcttcaaggagaactacaaaccactgctcaatgaaataaaagag
gatacaaacaaatggaagaacattccatgctcatgggtaggaagaatcaatatcgtgaaa
ATGACCATACTGCCCAAGGTAATTTATAGATTCAATGCCATCCCCATCAAGCTACCAATG
ATTTTCTTCACAGAATTGGAAAAAACTACTGTAAAGTTCATATGGAACCAAAAAAGAGCC
CGCATTGCCAAGTCAATCCTAAGCCAAAAGAACAAAGCTGGAGGCATCACTCTACCTGAC
TTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACCGGTACCAAAACAGA
GATATAGACCAACGGAACAGAACAGAGCCCTCAGATATAATGCCACATATCTACAACTAT
CTGATCTTTGACAAACCTGAGAAAAACAAGAAATGGGGAAAGGATTCCCTATTTTGGAAA
TGGTGCTGGGAAAACTGGCTAGCCGTATGTAGAAAGCTGAAACTGGATCCCTTCCTTACA
CCTTATACAAAAATTAATTCAAGATGGATTGAAGACTTAAATGTTAGACCTAAAACCATA
GAAACCCTAGAAGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGGCAAGGACTTC
ATGTCCAAAACACCAAAAGCAATGGCAACAAAAGCCAAAATTGACAAATGGGATCTAATT
AAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCGTCAGAGTGAACAGGCAACCTACA
GAATGGGAGGAAAATTTTGCAATCTACTCATCTGACAAAGGGCTAATATCCAGAATCTAC
AACGAACTCCAACAAATTTACAAGAAAAAAACAAACCACCCCCTCAACAAGTAG
gcgaaggatatgaacagacacttctcaaaagaagacatttatgcagccaaaagacacatg
aaaaaatgctcatcatcactggccatcagagaaatgcaaatcaaaaccacagtgaggtac
catctcacaccagttagaatggcgatcattcaaaagtcaggaaacaacaggtgctggaga

Exon 14 +      66092      66164   0    Initial     73    59    Marginal
gggtagatacccggtagggggattgctggatcgaatggtagttttacttttagttctcta
aggaatctccataccgtttcccagaatggttgtactagtttgcattcccaccagcagtgt
aaaagtgttcccttttcaccacatccactccaacatctattattttttgactttttaatt
ATGGCCATTCTTGCCGGAGTAAGGTGGTATCTCATTGTGGTTTTAATGAGCATGTCCCTG
ATAATTAGTGACG
gtgagcattttttttcatatgtttgttggctggttgtatatctttcttttcttttttttt
tttttttttgagaattgtctattcatgtcctttgcccacttttggatgggattttgcttt
tttcttgccgatttttattgagtttcttgtagattctggatattagtcctttgttggatg

Exon 15 +      66698      66743   2   Terminal     46    92   Excellent
cattgtagattctggatattagccctttgtcagatgagtagattgcaaaaatttcctccc
attctgtaggttgcctgttcactctgacggtagtttcttttgctgtgcagaagctcttta
gtttaattagatcccatttgtcaattttggcttttgttgccattgcttttggtgttttag
ACATGAAGTCCTTGCCGATGCCTATGTCCTGAATGGCATTGCCTAG
gttttcttctagggtttttatagttttaggtctaacatttaagtcttcaatccatcttga
attaatttttgtataaggtgtaaggaaggaatccagtttcagctttctacatatggctag
ccagttttcccagcaccatttccaaaatagggaatcctttccccatttcttgtttttgtc

Exon 16 +      67727      67859   0    Initial    133    67    Marginal
ccatttgacccagccatcccattactgggtatatacccaaaggactataaatcatgctgc
tataaagacacatgcacatgtatgtttattgcggcactattcacaatagcaaagacgtgg
aaccaacccaaacgtccaacaatgatagactggattaagaaaatgtggcacatatacacc
ATGGAATACTATGCAGCCATAAAAAAGGATGAGTTCATGTCCTTTGTAGGGACATGGATG
AAGCTGGAAACCATCATTCTCAGCAAACTATCGCAAGGACAAAAAACCAAACACCGCATG
TTCTCGCTCATAG
gtgggaattgaacaatgagaacacatggacacaggaaggggaacatcacacaccggggcc
tgttgtggggtggggggacgggggagggatagcattaggagatatacctaatgttaaatg
acgagttaaggggtgcagcacaccaacatggcacatgtatacatatgtaacgaacctgca

Exon 17 +      71603      71725   0    Initial    123    64    Marginal
aaaagaagtctgttgaaaagatacactatggaccttgggctcaaagacctacggtaggaa
gctctgagtaggatgtgagaaaaatcaatgtgacagtgaaaaacaattattatgtacaac
tcttttatattctaaagaagggggttaagaataaagatccttgatgtgctgatcagggtg
ATGAGTCTGAGGATTCAGTCATCAGAATCTCACAGAGATAAATGGCTCCACAGAGAAAAG
AGATTTGAAGGGAATGAGACTGTTCAGGAAGAACAGGAGCTGATGCCCATCCATCTCATG
AGG
gtatgaggaagagaggcaagatagtctaacgcagactgtttggtgacatttcactgggac
acgtgccattgaatctcccccgtttgtccccatgaagacgtctacaaatgcgcattgaat
gttttggtaatcagatttatcattggtttgggggtggggggtgaatttcagcatctactg

Exon 18 +      77089      77143   0    Initial     55    50    Marginal
acttaacatgcactcaaaaacatagccaagaaatacataaagcacgatgttcagagttac
aagaaggttgccacaataaaatataaaagtgcactattttagagttggggcagttccaag
aagtagcaagatccagggagtgcccctgagcatggcagtcaaataagaggtcttgcgacc
ATGAGGCTTGGAATCAGACTGGTTTTCTACATGGACATTGAAATCACCCAGGACT
gtgacaagattaggtgtagaaactctgaatgagacataaaaatctttgaccaaaagacca
atacgttggttttattttagaaagccatctttgtaagatgcccaggatggccataaaatt
gaatgtgtattggtcagggatatttaaactacaactaacagaaagtgcaagtctcgctgg

Exon 19 +      79738      79801   1   Internal     64    60    Marginal
aaagttaatttacataggacacctagttcaggtgtatgtatctgttcaaaccaaaagcgt
tagagtatttatgtttaatttaacaacgtcgcaaccgttctgatacttaggggagttctg
agtaagtaagttctagaaaggggagttccagtactcccctttctctcttttctgtgttag
GTAAAGCCACCCCTCCTAAAGCCACTAGCATGGATCCCCAAAATGTCCACCACAGAACGA
AAAG
gtaaaagaaggagaagttgttcctgttaaatcctgccgtatcacacgcaagagaaatggc
ttatcaacctgcctcaccccagtaaacacagcgcctaataaattcagtgcctaaactgga
ccccggacatatgaatctttgtccacagagttaccttcccccactgtttgtgcatattag

Exon 20 +      80755      80886   0     Single    132    42    Marginal
tcactagtatattcaactttaactgtggtggaaaatttggtctgttgagttttcttctgc
ttatttatgtagccaggccacagtgcgggaacctagcaaagtaatcccaatgcttgtata
gcattgtttgcctctgcaagcaaatcagaaagactccactccaccaaatttattttggac
ATGCAGGTGAAGCTGCAGTTTCCCACACAAACCAGCAAAACAGGTGGTCGTGAAATTGCG
ATTAACAACAACTGCAATGTGTACTCTCCTTCTCTTTTCTCTATCCTTTCTGGGGAGACA
CAGGCAGAATAA
aaatacagtgaaatctaattataattcagattccactcatacaaaattgttgcagttcag
gccagagccaggtatgatgttttaaaagtgctaatctttctcttttcagtaattttttta
aagaaggaaatgttttcagctaacctcaaacattttatactgactttcatatatacatat

Exon 21 +      82253      82294   0   Terminal     42    70        Good
tgggaggttatctggaggtaccaccatctcagtaatatgggcaatctcagagctccaggt
ctcatgaacagaacggtctcctgaaacatgcagatcaggagaactctgcagtggttggat
tctactgtcaggaagttgacccaagctcacccacctatcctgggtacttgagccttgcag
GATCCTAAGGCTGCAAGCCACGTGGATGCCACCATCATGTGA
acactacaattatgagccctactgatagggccctactggtcatatcagcaccaagggctc
taaaactttgaggtcatgtggcctctcttgtcatgttgctcctatggtcatgtgatgggc
ccagctcttccagtcactacagtatggtggactcctgaaccctgttgctcacatggattc

Exon 22 +      83183      83347   1   Internal    165    65    Marginal
ggcgtggctgagcaatctccaaatagcagaggctctgagggggtggggtggggtggggtg
ggtggggggtgccgggggtgcgggagggtggggggtgcgggaggtgcgggagggtggggg
ggtggggagggtggggggtgcgggagggtcggggtgtatggggggtttgggtggaggtag
CGGAGGACTTCCCTAATGTGGCCGAACTTGTGAACACCTGGCAGAGAAACTGTGTGTGCG
TGCGTGTGTGTGTGTGCGTGCGCACCCATGCATCTATGTCTGCCATCCGCCTTGATCCTG
GACTCACAGGAGCTGTTGTTGGAGGAGAAGGCACTGGGGCAGAAT
gtggggctgggggataggggtagggttggtagtggggcggcagggattcatgaactcgta
agtcgtttctcaggggcagggctgtggaagcctgatgggattccccccccttcccgcccc
cacactaaaagccctacccttgcctgtcactctgcccgattcaccgtctgtgccaggtga

Exon 23 +      84694      84763   2   Terminal     70    64    Marginal
acatcttctaacactttaaaaccttgtgcctttgtttactcagaacaatggaatgtgggt
ttataatagttgtaatctagtctgctcattaagacattgattgttgctctttaattcatt
ttatctcatgtcatcagtcagtctctcctgcttgaatctttgtacttttttactcttcag
AGATACCGCCAAGCATGCATCTGATACCATGGTGGTGGCAGACAATATGTGCATAAATGC
AAGTCATTAG
gaagccttacctgtggcagcaaataaagtgcccccactcttgaaaacaaggtacaactta
cctgtcaggacaagcagatgcagtaccgctcattttacacaataaaaaaccacacttctt
cagaaccattttattattacttaataattacagctgccatagtttgagcccctgtcatat

Exon 24 +      85986      86120   0     Single    135    58    Marginal
aggtggtagatgaaaggacttttcattgatcatttacttaatgtggaataatccccatgt
cttaccgctatgttgaggaaaaatgataaaaaaatagagcctaccttgatgaaagtgaaa
acaccatgtgagagagttgaacaaaattgctagatgtcagtgtttcagaagcgcaggata
ATGATAAAATCTCTGGCCACACGGGCAGAGAAAATTAGCGAGGTGGTGCGGGTCAGCCAC
TTTTGGAATGAAGATAGTGTCACACTTACAGTGACAGAAAAGATTGAAAAAGATCACATT
ATGAAAAGGATGTGA
aaatttgaaaatttagattaaattgatgaattccaggggaaaaatatatataactttcca
aactgaaggaatagaaaaccttggtttattcaatgtattcttgacaaggaatacatgcaa
aggcaaaattactagccaacccgaattagttacataaacgcaaataatataaatcaatta

Exon 25 +      94151      94371   0    Initial    221    58    Marginal
ttcaacacagttgcttcctctcccaagattcctaccctgattgtgccacctgtgagataa
ggctcttgtatctggacaggcagaggagtttgttttctggggcttatgtggcgggttggc
actttgctagccctaccatggagttagctcacgacgtggtacgtggtaagtggaccattg
ATGTGTCTCAAACTTGTCTTTTTGTTCTCAGTTGCAGAATGCCATGACCATGGTAGCACT
TTTCAAGGAAGAAAGAAAGGTGGGAGTTCTTTCCGGGATAATTTTGACAAGAGGAGCTGT
CATTATGAACATGGTGGGTATGAGCGCCCGCCTTCACACTGCCAGGAGAATGATGGAAGC
GTGGAGATGAGGGATGTCCACAAGGACCAACAACTAAGACA
gtaagtgaccaggcagcctggtttgcacgtagcagcccccgggactgtgcaaccctttca
ttctctgtggtcttccttttcttctctcattagagaactgacgaatgctggaagtggaat
agtggctgagcaatcctaattgtagccctggcgtcagtgagtggagcatgtataggagac

Exon 26 +      94598      94748   2   Internal    151    94   Excellent
gtgcaaccctttcattctctgtggtcttccttttcttctctcattagagaactgacgaat
gctggaagtggaatagtggctgagcaatcctaattgtagccctggcgtcagtgagtggag
catgtataggagactttcttagatttaatggatacccgccttctctcctcttccccacag
CACTCCTTATAGCATCCGATGCGAAAGAAGAATGAAATGGCATAGTGAAGACGAAATCCG
TATTACCACGTGGAGAAATAGAAAACCTCCGGAGAGAAAAATGAGTCAGAACACACAGGA
TGGATACACAAGGAACTGGTTTAAGGTCACA
gtgagtatcttggtggggtctgcattaggtggactattctggaacctgatagaaggaaga
ccacttaaaacaccctaagttgattatttggaggagagcttcggaatggggggaaaggga
gtttagggcatctatatttggcacaaaaataagaaatcatgtcagcggtcctttctttag

Exon 27 +      95052      95135   0   Internal     84    98   Excellent
tagggcatctatatttggcacaaaaataagaaatcatgtcagcggtcctttctttagaaa
tctaagctaagtagaaggttggaaagaaagaaaaaaaaaacccagctggttggttctgtt
ctccatccttagttccacgttgtctctcccttccctcctatttcttctttttacccttag
ATTCCTTACGGGATAAAGTATGACAAGGCATGGCTAATGAATTCAATCCAGAGCCATTGC
AGTGACCGCTTCACTCCGGTTGAT
gtaagagaggatggtgaagccagatgagtgggcatgggggacggggagaggcctggctca
gcaggggccattggcctctgacgctgttgctcttgccttcactccctgtagttccactac
gtccgaaatcgggcatgcttctttgtccaggatgctagcgctgcctccgcattgaaggat

Exon 28 +      95247      95351   0   Internal    105   100   Excellent
aagtatgacaaggcatggctaatgaattcaatccagagccattgcagtgaccgcttcact
ccggttgatgtaagagaggatggtgaagccagatgagtgggcatgggggacggggagagg
cctggctcagcaggggccattggcctctgacgctgttgctcttgccttcactccctgtag
TTCCACTACGTCCGAAATCGGGCATGCTTCTTTGTCCAGGATGCTAGCGCTGCCTCCGCA
TTGAAGGATGTCAGTTATAAGATTTATGATGATGAGAACCAAAAG
gtgtgtgccgagggcatgccctgtacttagtctctgggcaggaggacaggccagggggct
ggtcatcctctttgggattagaggtcctggtacttaccaccctgccttcctgcagatatg
tatatttgtcaatcattctactgcgccctactctgtgaagaataagttgaagccaggcca

Exon 29 +      95694      95807   0   Internal    114    67    Marginal
taagttgaagccaggccaaatggagatgctaaaggtaatacagactcaaggatcattgta
tgtccacttcctggacccacctcttcttcccctggccccctctttccctgtcaccacacc
accaccaccaccaccatcaccagagccccagagcctctgtcttcatctctatctctgcag
CTGACCATGAACAAACGGTACAATGTCTCCCAGCAAGCTCTTGATCTCCAGAATCTCCGC
TTTGACCCAGGTAAGGCTGACAGCAGCAATTCTAAGACAAGCGGGGGCAGAGAG
gtctgcctgggagggagacttaggaatggcaatttacagaggggttggggctggctctgg
tccagccagggccctcccagccttccgattcccttctcttggcttcttcaagacttgatg
ggccgtgacattgatataatcctgaatcgaagaaactgcatggctgccaccctgaagatc

Exon 30 +      96416      96520   0   Internal    105    98   Excellent
ggtgagaagggggagccagatcaactttgggtggagggcaggacacatcaggataatggc
aacagccaggcagtggcacctgtgggtgactatgagggccgggggaattcagggcccagg
gtcctgggtgtctctctttccctggccctccttctccagtttcctccccatctttcttag
CTGGAGTCGGCGTGGGAGTTGGGCAAGGTGAAAGGGCTGAAGCTCGAAGAGCTATGGCTA
GAAGGGAACCCGTTGTGCAGCACCTTCTCGGACCAGTCCGCCTAT
gtaaggtcagtggcaaccccggtcacccttcctgggcacctttgctccctgggtgactga
gctgtgtctgaaggtgcccttctgcaggaagaagcagccttggtcctctgggaggaccac
agacctcccttcctactctctctctctctctctctctcctctctctctgtcactcactca

Exon 31 +      98618      98721   0   Internal    104    85        Good
cacacatttgcatgtgatagtagagatgtccagcaccccatgagaaagccacccactgga
atttccagggccatttcccacctagcctctgatgcttgtctccctgggcatgttcatctt
atcgatcatccagctccatctccttggtctccactgctgacttcctctttccttctccag
GACGGCCGAGAGTTATCCGCACCAGTGATTGTTGACATTGACAGCTCTGAGACAATGAAA
CCCTGCAAGGTGAGGAAGAAGGACCAAGCAAGATTTGGGTTGCT
gtaagggaggctttgtccaccgcatagatccaaattgtcttttgatttcaggaaaacttt
actggatctgagaccctaaagcatttagtcctgcaattcctgcagcagtgagtatccctg
ggaccatgaggaaggggagggctgagacaggctgggccacccgtgcagcctgggagtttt

Exon 32 +      98960      99067   2   Internal    108    98   Excellent
ttactggatctgagaccctaaagcatttagtcctgcaattcctgcagcagtgagtatccc
tgggaccatgaggaaggggagggctgagacaggctgggccacccgtgcagcctgggagtt
ttcaagtctcatctggggcccaggccacagagatagcctatcctcactgcttccccacag
GTATTACTCGATCTATGACTCTGGAGATCGACAGGGTCTCCTCGGTGCTTACCACGATGA
GGCCTGCTTCTCCTTGGCTATTCCCTTCGACCCCAAGGACTCAGCCCC
gtgagtatcacggctcagaccctgctctggggctgtgtgtctccccagcagacacaggcc
aactcctggaaatgcccacactggccggaccacccactcctgctcctctttttctcctag
gagcagcttgtgcaagtactttgaggatagcaggaatatgaaaacactcaaggacccctg

Exon 33 +      99188      99246   2   Internal     59    99   Excellent
ttaccacgatgaggcctgcttctccttggctattcccttcgaccccaaggactcagcccc
gtgagtatcacggctcagaccctgctctggggctgtgtgtctccccagcagacacaggcc
aactcctggaaatgcccacactggccggaccacccactcctgctcctctttttctcctag
GAGCAGCTTGTGCAAGTACTTTGAGGATAGCAGGAATATGAAAACACTCAAGGACCCCT
gtaagtgtgtgatggggaagagtgggcaaggtaagggggtgtgatgggaacaatcacagg
ggccaaggaccaggatgtggtagccccccgccctgccccgcccaccctgccattccttgc
ttctcctctcctctacagacctgaagggggaactgctgaggcgcacaaaacgtgacattg

Exon 34 +      99385      99544   1   Internal    160   100   Excellent
actttgaggatagcaggaatatgaaaacactcaaggacccctgtaagtgtgtgatgggga
agagtgggcaaggtaagggggtgtgatgggaacaatcacaggggccaaggaccaggatgt
ggtagccccccgccctgccccgcccaccctgccattccttgcttctcctctcctctacag
ACCTGAAGGGGGAACTGCTGAGGCGCACAAAACGTGACATTGTGGACTCCCTCAGTGCGT
TGCCCAAAACTCAGCATGACCTCAGCTCCATCCTGGTGGACGTGTGGTGCCAGACGGTGA
GCACCTGCTTCCTCCCTTGGGCAGGCCCAGAGAGCCAGAG
gtgggtaggaggttaaggaggatcctgagcacctgagcgcttccttttcaggaaaggatg
ctctgcttttctgtcaatggggttttcaaggaaggtgagtgtctgtatagtcccctcccc
agatcccccactgctccctccccctggctgggctccctctcagaactcccccagcttccc

Exon 35 +     100846     101028   2   Internal    183   100   Excellent
ccaaaggtggactctgtgggagggttagagggtaccagccaaaaaatctgggaggcaggc
acagttagggatatggaaggaatttggttgttgagtggcagtggttaagaaggatcctgt
tgttgggggtgcggagttatctacttgtccagtttgagggtgcatttttctttcctccag
TCTGTGCATCGTGAATGACGAGCTGTTTGTGAGGGATGCCAGCCCCCAAGAGACTCAGAG
TGCCTTCTCCATCCCAGTGTCCACACTCTCCTCCAGCTCTGAGCCCTCCCTCTCCCAGGA
GCAGCAGGAAATGGTGCAGGCTTTCTCTGCCCAGTCTGGGATGAAACTGGAGTGGTCTCA
GAA
gtgagtgctgggagtacatggggatgggggctgttgggacatcagaggaatgagtaatgg
aaactcacatgcaatttggaaaaataactatctgggtattttgcttccaaaaaaagtggg
tccatgaaaaaggtatcatacttttatactggtatatgtaaatatttttttaaatggcat

Exon 36 +     103439     103574   2   Internal    136    83        Good
gcattaatgtcagggatgggcgttttggttttccccaggccttttttcattgttacaata
gtgctcatattggtacatgtgacccagcaaaaaggtagcatagattaagggtggcattgc
atagtcagcgtgtctgtcctgggctagtaatggagagcacctgttcttctcccaccccag
GTGCCTTCAGGACAATGAGTGGAACTACACTAGAGCTGGCCAGGCCTTCACTATGCTCCA
GGTGAGGTCTGGGAATCAAGTGGGTAAAAGACAGCTGTCTCTGGGTCGTCAGGAGGGCCA
AGAAGATGGAGGCCAG
gtagtgtggggatggaacccagtgcacctggctctactaacatcccaactccttttcttt
actttctctagaccgagggcaagatccccgcagaggccttcaagcaaatctcctaaaagg
agccctccgatgtcttctttgtcttcgttcacatcctctttgtttcctcttttcaccagc

--------------------------------------------------------------------------------