--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10674 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3185       3514   0   Internal    330    68    Marginal
cctcttctgccatcagttcttgctcagaggaaagggaggccttgttgggctgaggtggtc
agagcacaccgcaggtaggagtcagtacaggtcagagaagtgtggccttggaattttgga
gccatttgcttagttgggggtgaggagaaggtctatgaacttccctgcttcctcttgcag
GCTGAAGCTTCAGAAAAGGACAGTAGCTCGATGATGCAGACTCTGTTGACAGTGACCCAG
AATGTGGAGGTCCCAGAGACACCGAAGGCCTCAAAGGCACTGGAGGTCTCAGAGGATGTG
AAGGTCTCAAAAGCCTCTGGGGTCTCAAAGGCCACAGAGGTCTCAAAGACCCCAGAGGCT
CGGGAGGCACCTGCCACCCAGGCCTCATCTACTACTCAGCTGACTGATACCCAGGTTCTG
GCAGCTGAAAACAAGAGTCTAGCAGCTGACACCAAGAAACAGAATGCTGACCCGCAGGCT
GTGACAATGCCTGCCACTGAGACCAAAAAG
gtcagccatgtggctgatacaaaggtcaatacaaaggctcaggagactgaggctgcaccc
tctcaggccccagcagatgaacctgagcctgagagtgcagctgcccagtctcaggagaat
caggatactcggcccaaggtcaaagccaagaaagcccgaaaggtaagacctctgcagtca

Exon  2 +       3218       3676   0    Initial    459    83        Good
gggaggccttgttgggctgaggtggtcagagcacaccgcaggtaggagtcagtacaggtc
agagaagtgtggccttggaattttggagccatttgcttagttgggggtgaggagaaggtc
tatgaacttccctgcttcctcttgcaggctgaagcttcagaaaaggacagtagctcgatg
ATGCAGACTCTGTTGACAGTGACCCAGAATGTGGAGGTCCCAGAGACACCGAAGGCCTCA
AAGGCACTGGAGGTCTCAGAGGATGTGAAGGTCTCAAAAGCCTCTGGGGTCTCAAAGGCC
ACAGAGGTCTCAAAGACCCCAGAGGCTCGGGAGGCACCTGCCACCCAGGCCTCATCTACT
ACTCAGCTGACTGATACCCAGGTTCTGGCAGCTGAAAACAAGAGTCTAGCAGCTGACACC
AAGAAACAGAATGCTGACCCGCAGGCTGTGACAATGCCTGCCACTGAGACCAAAAAGGTC
AGCCATGTGGCTGATACAAAGGTCAATACAAAGGCTCAGGAGACTGAGGCTGCACCCTCT
CAGGCCCCAGCAGATGAACCTGAGCCTGAGAGTGCAGCTGCCCAGTCTCAGGAGAATCAG
GATACTCGGCCCAAGGTCAAAGCCAAGAAAGCCCGAAAG
gtaagacctctgcagtcaccacccttggttttctactcctctctcagttgattcatttgt
tctacaaacatttagaaagatccctgtgctcatcagggctgtggggggcactgagagtaa
tgtgatgtaattcctgtcttcagagagcttgcagactgatggggaggtgcaatctgaatg

Exon  3 +       4713       4776   0   Internal     64    77        Good
cagtcatcccaagagcctgaagcaccaccacctcgggatgtggcccttttgcaagggagg
gtaagaactctgtcgtttttattctgccttttctactgccttggctgtccttttctttgc
catcgtctcaagttttctgcaaacttgttttggtctttccatctttttctactctgccag
GCAAATGATTTGGTGAAGTACCTTTTGGCTAAAGACCAGACGAAGATTCCCATCAAGCGC
TCGG
gtaaagtcctaccaatcctccctctgccctgagctctgccctccattgcccttacaccat
tgtgctggggatatcccctgctcttatgcttatgtctctgtcctcccaaagttctgattt
ggcagtgctagcatctctgttgataagcacagaaccgggttatgccacccttggtgtggt

Exon  4 +       5037       5116   1   Internal     80   100   Excellent
ctcttatgcttatgtctctgtcctcccaaagttctgatttggcagtgctagcatctctgt
tgataagcacagaaccgggttatgccacccttggtgtggttggcaaagagtctatagctt
gggcatcagggccacctggcatctcttcagtcaggtgctcacaacactctccccttgcag
ACATGCTGAAGGACATCATCAAAGAATACACTGATGTGTACCCCGAAATCATTGAACGAG
CAGGCTATTCCTTGGAGAAG
gtgaaggggcagccctgggggatgggcacagtggggaagccttgaattgaacaaaaatgt
acaagtcccttctcgggaaccaaagagacctgctaatccagctccatcgctatgctgagg
ggcagacagtggcctagggaggggtgtagattagcgatgggtcacacagcaagtcaatgg

Exon  5 +       6408       6515   2   Internal    108   100   Excellent
agagtagactgaggcttgcaagtctaagtgccttgccaagggtggcatagagctggaagc
agagactgggtagaattctgtatctgaggaatctgggagaggctagcctagtgagttggc
tggtgtgtctgttgcagatggctgctgaacataaacctctctgtcctgttatttctctag
GACTAAGGACTCACCCAAGCTGGGTCTGCTCATGGTGCTTCTTAGCATCATCTTCATGAA
TGGAAATCGGTCCAGTGAGGGTGAGTGGCTGGGCTTGCAGCTGAATGG
gtggctgtggtctagattccatgtgttcaatttctgtccctgtctcctcttgcctcccct
cgcagctgtcatctgggaggtgctgcgcaagttggggctgcgccctgggtatgattgggc
tctctcagcgcttgctgtccgtgttgtcctttggcaagagaggacggtcctaggattgca

Exon  6 +       6581       6725   1   Internal    145   100   Excellent
tctctaggactaaggactcacccaagctgggtctgctcatggtgcttcttagcatcatct
tcatgaatggaaatcggtccagtgagggtgagtggctgggcttgcagctgaatgggtggc
tgtggtctagattccatgtgttcaatttctgtccctgtctcctcttgcctcccctcgcag
CTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGTATGATTGGGCTCTCT
CAGCGCTTGCTGTCCGTGTTGTCCTTTGGCAAGAGAGGACGGTCCTAGGATTGCATCAGT
CTGGTGGTCTGGTGGAGCGGGTGGG
gtgctggactgggtagagggcccagggttctgacctgggtggatgatgggtgaatggtcc
tgaactctctgctccctctctcagtgtctcttgggcttctatggagcttccctcttgtgc
tggaaacctcttttccatcttggaaatgcctctgcccacatctgggaagtgccatagcct

Exon  7 +       6951       7017   2   Terminal     67   100   Excellent
atgggtgaatggtcctgaactctctgctccctctctcagtgtctcttgggcttctatgga
gcttccctcttgtgctggaaacctcttttccatcttggaaatgcctctgcccacatctgg
gaagtgccatagccttgagtgaatttatttgtttatttatttttctttttcttctctcag
GATACATCATTCACTCTTTGGGGACGTGAAGAAGCTCATCACTGATGAGTTTGTGAAGCA
GAAGTAA
gtatctctgtctggtgttcatgtgtcccatgcatttggcctatttcagaactgagtgata
aagccgtggtgcatggatgcatgtgtctatgtgtgtatgtatttgcatatttgcatgtat
gcaggtgggattattccttgggcggtgatgggaaacaggagcagcacatgtttcctgatc

Exon  8 +       8080       8238   0    Initial    159    73        Good
ggggtcattgtgatgagggcgtcaaacttgtggcttccctatgaacaaacgtcccccaac
acctctatgtggcttctgggcaagaccagtgggacagggctcaatattggaagaaagact
gtagtaattagtggatgatgttgccatctggagcctgtccagtctatgcatgggtaggcc
ATGAATGGTCTTAGAAATAAAGGCTTTGAACCTCTCTTTCCAAGGTACCTGGACTATGCC
AGAGTCCCCAATAGCAATCCCCCTGAATATGAGTTCTTCTGGGGCCTGCGCTCTTACTAT
GAGACCAGCAAGATGAAAGTCCTCAAGTTTGCCTGCAAG
gtaattggagagctccttgagcttggcaagtcaagagcatggggtgcccctggctggggc
aggctgtgtgcagagcagcctgcagttcaaatctgaatgttttggtgcttctgttaattg
tcaaaacactgtaacaggcactttatctgaatcatttaagccttacaacctgatatgtca

Exon  9 +       8711       9145   0   Terminal    435    98   Excellent
actggtaatactgtattattactattatctttttatactaagcatgtagcatagtgccta
gcataaaggtagatgcttaatcctcttatgctccttctgatggttatttacatagtaata
ctgtattattactatggcttaatccctctatgctccttctgatggttatttttgtttcag
GTACAAAAGAAGGATCCCAAGGAATGGGCAGCTCAGTACCGAGAGGCGATGGAAGCGGAT
TTGAAGGCTGCAGCTGAGGCTGCAGCTGAAGCCAAGGCTAGGGCCGAGATTAGAGCTCGA
ATGGGCATTGGGCTCGGCTCGGAGAATGCTGCCGGGCCCTGCAACTGGGACGAAGCTGAT
ATCGGACCCTGGGCCAAAGCCCGGATCCAGGCGGGAGCAGAAGCTAAAGCCAAAGCCCAA
GAGAGTGGCAGTGCCAGCACTGGTGCCAGTACCAGTACCAATAACAGTGCCAGTGCCAGT
GCCAGCACCAGTGGTGGCTTCAGTGCTGGTGCCAGCCTGACCGCCACTCTCACATTTGGG
CTCTTCGCTGGCCTTGGTGGAGCTGGTGCCAGCACCAGTGGCAGCTCTGGTGCCTGTGGT
TTCTCCTACAAGTGA
gattttaggtatctgccttggtttcagtggggacatctggggcttatggggctgggatga
ggagctggatgattctaggaaggcccaagttggagaatgatgtggagagtgtgccaagac
actgcttttggcattttattcctttctgtttgctggatgtcaattgacccttttattttc

Exon 10 +       9867      10013   0    Initial    147    58    Marginal
tagattgggcatcacgtctagccttcagggtggtgggattttagtggggtggagttcaag
agattgtagttacagaggacacactttgaaggagaggcttgaggtcggcaagtctagagc
agaaagtgtaagtagaggagactggacatcaaatatagaatccctttttgagaaatttga
ATGAGGAGAGAGAGGGGTACAGAGCTAAATGGAGATACAGGAACAAGGGAGCATTTTCTT
GGGGAAGGAGAGAGAGACTTGAGTAGGGAGGAGTCAACGGAGAGGGAGAAGTTGAATGTT
GACTTTTGCAGCCCAGTCCTGGAGGAG
gtgagaggagttgggttgtgggaaggcctgggagaagggactactcggataggactcaga
gagggggactgtgagaggatgttgagcagtagggaggccccagtagaggatggagcccat
gatttttgggggaacatagcaaggtgctcagtaatcttggtataggaaccatgaagatga

--------------------------------------------------------------------------------