--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (69337 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1244       1331   0    Initial     88    47    Marginal
ccgcctcctccggccgctctcgccggctcaggttacctgaggccggtgggcggggcggcc
cttcccgtctgcgccggcccccagcctccagggcggcggagccgggaagtggaagaggga
gcgaaggaggcggggactgccaaggctccagcccggccgggctccgaggcgagaggctgc
ATGGAGTGGCCGGCGCGGCTCTGCGGGCTGTGGGCGCTGCTGCTCTGCGCCGGCGGCGGG
GGCGGGGGCGGGGGCGCCGCGCCTACGG
gtgagtgcgaccctcggggcccgaggggcggccggagggctgagggcggtgagggtcacg
gctgaaaggccccggaggtcaacgccgggcggagggccgaagctggggtgggtgctgggg
gctgccctcgcgaggccccgcgctcggcggctgcggcttcccgcgcgggatctctggggc

Exon  2 +       8262       8418   2   Internal    157    50    Marginal
ttttaagtcaattttcttacactcctagtttgttgagtgtttttatcatgaaaagtaaat
tttgtctaatgctttttctgtatcaattgagatgatcaggtagttttttcccctttattc
tgttaatgtggtatattacattgatcaagttttgtatgttaaaacatctttgtattccag
GAATAAATCCCACTTGGTCATGGTCTATAATCCTTTTGATATGCCCGTGTATTCACTTTA
CTGCTATTTTGTTGAGAATTTGTACATCAATGTTCATAAGGCATATGGGTCTGTAGTTTT
CTTTTCTTGTAGCGTCTTTGTCTGGCTTTGGTATCAG
gtaatgctggcctcgtagaatgagttacgaagtttgagaaggtttggtactagttcttta
gatgtttggtagaattttatctgtgaagctatcaggtctagggcttttctttgttgagag
atttttgattactgattcaatctccttactacttataggtctgtttagatttcctatttc

Exon  3 +      20559      20649   0   Internal     91    94   Excellent
tattaccaaatgtctctgagagcggtagggagaacaaaatcagccccaattgagaatcac
tgatctataccatttgataacttttttgataaaaaaagcaccacatttagacatgctaat
gtttcattatataagtgtgtgttagctgaagcaatgcctttttcaattttctaaccttag
AAAATAGCTCCGGAAACTCGTCGTTCAATAGAAGTACCCCTGAATGAGAGGATTTGTCTG
CAAGTGGGGTCCCAGTGTAGCACCAATGAGA
gtgagaagcctagcattttggttgaaaaatgcatctcacccccagaaggtaacaactgaa
agcgctatctcttggtgtttagagaataaatctgaatgctccaatgcttttgtgcattgt
tcattaattaattcaattctcaaacattttctgagtctaataagtgccaggcattgtact

Exon  4 +      23263      23383   1   Internal    121    52    Marginal
aattagatttgagtttcctccatcctgggtgacttctgggtaaaatggggtgagagatga
agcatttgctttctgacaaagcagcatgaagcactctcatcatccccatgccaaagagtg
atttgctactttgcattacaaggaaagaagggtcttaaactcttggcctggatattctag
GTGATCCTGAGTCTGCTGTGACTGAGCTTCAATGCATTTGGCACAACCTGAGCTACATGA
AGTGTTCTTGGCTCCCTGGAAGGAATACCAGTCCCGACACTAACTATACTCTCTACTATT
G
gtgagtatgtacagtacaattactggaagactgattgtaattgtgttgggagcctttgga
tccaacctagtcaaaaaaaaaagaactgtttaattttttctgcaaactcaacaagatgga
cagtttgcttcaatgaaaaatgcatctgtctttggtgtctactttttaaataaactttct

Exon  5 +      31660      31847   2   Internal    188    98   Excellent
gagacagggtttcaccatgttggcaaggctggtttccaactcctgacctcaagtgatccg
cctgcctcagcctccaaaagtgctgggattacaggtgtgagccaccgcgcccagcctgct
cttatttcttgaatactctgttgaatataatgcagaagattgtctcattttatcttgtag
GCACAGAAGCCTGGAAAAAATTCATCAATGTGAAAACATCTTTAGAGAAGGCCAATACTT
TGGTTGTTCCTTTGATCTGACCAAAGTGAAGGATTCCAGTTTTGAACAACACAGTGTCCA
AATAATGGTCAAGGATAATGCAGGAAAAATTAAACCATCCTTCAATATAGTGCCTTTAAC
TTCCCGTG
gtaagttttagaagtcctctaaaacagtatggataaaaagtgtgttatatcttttgcaca
atcaatacaaataataaaaaatgatcattctgggtttaagatcttctgaaagaagggact
atattgatgtataactttctttgatagatcctttttaaagaagtaaacttggaaattctt

Exon  6 +      34743      34906   1   Terminal    164    78        Good
taaatgagaagaaaaaactctgtacatgttcagcacagatgctattttttaaaaaatatt
ttcagttcatggttggttgaattcatgaatgtggaatccatggatatggagggccgactg
tgtgtttgtgtgtataatcaagctttggaagcttacttgtgttctatttttgtttttcag
TGAAACCTGATCCTCCACATATTAAAAACCTCTCCTTCCACAATGATGACCTATATGTGC
AATGGGAGAATCCACAGAATTTTATTAGCAGATGCCTATTTTATGAAGTAGAAGTCAATA
ACAGCCAAACTGAGACACATAATGTTTTCTACGTAAGGTTTTAA
aattattgtttttatttggctatttttcttttacttgaatttcttacattgaaatatcaa
tgaaacatagctcttacatttgtcaccttatgatgatgatggtaatgaaacttcttgtct
aaaataaggcatggtggaagatttgaagatttatggtatgatagtatcagctgcaagttt

Exon  7 +      43401      43625   0    Initial    225    93   Excellent
ttaataagattacatatttaatatagcatctttgttaatagtatttaaaactagttaaga
tcttctgatttacctgagcgggtggggaaacccaccccatgagcatcccctgggctcacc
cagtgcacagagggaggcctcccgtggctgggcccctctcagtcagcccatgtggctgcc
ATGACCTGGAGCACCACAGCCGGGGGCGCCCACCAGCTCAACACCACCACATTCACGTGG
CAGCACCTCCCTGCCTGGCAACCGCTGCTGTTGGCCAGCATTAGGCTGCAGCTCTTCTTC
TACGTGGGCCTGGCCTTCATCAGCCTGGACCTCTATTACTCCTCCACCAGCATCAAGGAG
CTGGAGTACAACTACACCGGCGACCCGGGCACCAGCAACTGCTCG
gtgtgtgctgtggctggccagggctgtgtgccactgcccatctgctcatgcgcctggtac
ttctcactgcctgagctcttccagggccctgtgtacccctactacgtgctgaccaacttc
taccaaaacaaccggcggtatggagtgtccgcgacaacgcgcagctgagcgggctgccca

Exon  8 +      43571      43793   2   Terminal    223    82        Good
tgtggctgccatgacctggagcaccacagccgggggcgcccaccagctcaacaccaccac
attcacgtggcagcacctccctgcctggcaaccgctgctgttggccagcattaggctgca
gctcttcttctacgtgggcctggccttcatcagcctggacctctattactcctccaccag
CATCAAGGAGCTGGAGTACAACTACACCGGCGACCCGGGCACCAGCAACTGCTCGGTGTG
TGCTGTGGCTGGCCAGGGCTGTGTGCCACTGCCCATCTGCTCATGCGCCTGGTACTTCTC
ACTGCCTGAGCTCTTCCAGGGCCCTGTGTACCCCTACTACGTGCTGACCAACTTCTACCA
AAACAACCGGCGGTATGGAGTGTCCGCGACAACGCGCAGCTGA
gcgggctgcccagcacgctgcaccatccagtcaatgagtgcacccactgcgccgcctgcc
catcgtgcaccctgcaatgtcatcaccaacagcctcttcaacgactcctcgctgtggcac
cagtgctggcccggcgagccctacgtggaggtgccgcgctaccgcactgcacctgcatca

Exon  9 +      43982      44275   0   Internal    294    79        Good
cccagcacgctgcaccatccagtcaatgagtgcacccactgcgccgcctgcccatcgtgc
accctgcaatgtcatcaccaacagcctcttcaacgactcctcgctgtggcaccagtgctg
gcccggcgagccctacgtggaggtgccgcgctaccgcactgcacctgcatcacccggtag
ACCAACTACCCCATCAAGTTCTGCAACCCACCACTGGTCAACGGCAGCCTGGCACTGGCC
TTCCATGGCACAGCACCCCTGCCCAACTGGCGCTGGCTGGTCTACGACAAGCTCAGCCCC
ATCCCCAACAACAACGGCTTCATCAACCAGGACTTCGTGGTGTGGATGCGCATGGCAGCG
CTGCCCACGTTCCGCAAGCTGTTCCGCAAGCTGTACGGGCACATCCGCCAGGGCAACTAC
TCAGCTGGGCTGCCGCGGTGTGTCTACTGTGTCAACATCACCTACAACTACCTG
gtgcgtgcatttggcggccacaggctccgcatcttcagcagcatcttgtggatgggtggc
aggaaccccttcctgtgcatcgcctatgtggtggtcagctccctctgcatccttactggc
tttgtcatgctggtcatctacattagctaccaggacctaccagaaagatgatgacaatga

Exon 10 +      47484      47580   1   Internal     97   100   Excellent
gactttttttttttaaactattaatttaacagaagataagataattgaagagcttgggaa
aataggttgggggagggagcagaaatatttgtgatcttactagctaacagaattgctgct
tggtttattactaaaagggttttatttctcaagtctttctgtttgcttttcattctccag
GTAAGAAGCGCAATTCCACACTCTACATAACCATGTTACTCATTGTTCCAGTCATCGTCG
CAGGTGCAATCATAGTACTCCTGCTTTACCTAAAAAG
gtaaggtagctgcccaggcaggttttgcagtttctgatagcctgtttgctgtggttatta
cttttagtgcttgtgttttatgtctgcccagtgtattagaagcatgttgcctgtaagtgg
ctttcgggagtatgacatgacaaggaagtattaccacgcccactttcttttcttttcttt

Exon 11 +      54123      54221   1   Internal     99    96   Excellent
tgttcaaaactcgagattctcactcatctccctctctttagagatggggacatgaggagc
cacagagaagtttctcaaggactgtcactgtgttaagccaatcttgtattgctataaaga
catacctgaaactgggtaatttataaataaaagaggtttaattagctcatggttctgcag
GCTTCACAGGAACTGTGGTGCCAGCATCTGCTTCTGGTGAGTATCTCAGGAAGCTTACAG
TCATGGTGGAAAGTGAAGGGGGAGCAGGCATCTTACGTG
gtgagagtgggaacaagagggggtaggaggtgccatacacttttaaacagctcttatgag
aactcactgttgtgatgacagcattaagccatgagggatccacccctatgacccaaacac
ttcccaccaggccacacttccaacgttggggattacaattcagtatgaaatttggcaggg

Exon 12 +      65367      65459   0   Terminal     93    95   Excellent
tgtttcattaatcattcagatagataaagattcttaggtcaaaaaaaaaaaaaaaacagg
aaatcatacccctacggttccatccacacaaacctaaaaataagcattggcactaagtac
tcagggaaagaacactgtttagatatgtcattgtgtatgtgtttttttcctcccttctag
CACTGGAAGAAGTACGACATCTATGAGAAGCAAACCAAGGAGGAAACCGACTCTGTAGTG
CTGATAGAAAACCTGAAGAAAGCCTCTCAGTGA
tggagataatttatttttaccttcactgtgaccttgagaagattcttcccattctccatt
tgttatctgggaacttattaaatggaaactgaaactactgcaccatttaaaaacaggcag
ctcataagagccacaggtctttatgttgagtcgcgcaccgaaaaactaaaaataatgggc

Exon 13 +      67658      67896   1   Terminal    239    64    Marginal
aagtcagattgaggctgggagacagccgtagtagatgttctactttgttctgctgttctc
tagaaagaatatttggttttcctgtataggaatgagattaattcctttccaggtatttta
taattctgggaagcaaaacccatgcctccccctagccatttttactgttatcctatttag
ATGGCCATGAAGAGGATGCTGTGAAATTCCCAACAAACATTGATGCTGACAGTCATGCAG
TCTGGGAGTGGGGAAGTGATCTTTTGTTCCCATCCTCTTCTTTTAGCAGTAAAATAGCTG
AGGGAAAAGGGAGGGAAAAGGAAGTTATGGGAATACCTGTGGTGGTTGTGATCCCTAGGT
CTTGGGAGCTCTTGGAGGTGTCTGTATCAGTGGATTTCCCATCCCCTGTGGGAAATTAG
taggctcatttactgttttaggtctagcctatgtggattttttcctaacatacctaagca
aacccagtgtcaggatggtaattcttattctttcgttcagttaagtttttcccttcatct
gggcactgaagggatatgtgaaacaatgttaacatttttggtagtcttcaaccagggatt

--------------------------------------------------------------------------------