--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (17210 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1049       1307   0    Initial    259    47    Marginal
agcaaagaaagaggtactgtttacggagcgttcagccgtgagcccaggcgcaggcgcgga
gctaaacccggaggtgaagcaactacagctggggccacgcccacagactccgggctgtcg
gggcgggcggcactcgcgcttccagcctgggccaaccaggctgcttgaggctcgaagcgc
ATGCGCGGTCTCGCCCTCCGTACTGGCCGAGCCAGCAAATCGCATTGCGCAGACGACCAG
CGGGCGCCTCGGATTCCGCCCCCGGGATGGCCCCGCCTCCTCCCGCCCCGCGGCAAGGCA
CGCACAGGGCAGTGCGCGGGTGGGTGGGTCCTAGCAGCGCGGCCTGACGGGACCAAGGCG
GCGGGAGTCTGCGGTCGTTCCCTCGGCTGTGGACCGGGCGGCACGCACGCGGTGCAGGGT
AACATGGCGGATGCGGAAG
gtaagggctgcaggcttccgggccgtgctaactccgggcgactcggggaacgggggtggg
gggatggtatcggggcccgcgcacgcctccctctggttcccgccggcgtgtcggcctctt
caccgcccggccttaagccggccttgtctctcggccctggctccgtggcaagggcgcgag

Exon  2 +       3225       3334   1   Internal    110   100   Excellent
taatcttatgggggccaccatcacatacgcagtctgtacttgcaaaacattatgtggcat
gtgactgtaattgtagacctaaaatccatttcctacctgccctaatttcggtctttattt
taaacccttgtttcatttattcttggggaaaattcccaaatcctgtgtttgtttttttag
TAATTATTTTGCCAAAGAAACATAAGAAGAAAAAGGAGCGGAAGTCATTGCCAGAAGAAG
ATGTAGCCGTGAGTAGTAATGTGTTTGACTTCACTTTGACTAAAAAGAAA
gtttacttaaataacaaactaaaggaaagaagtgtttttaaaggtttccaaggaatgggc
cagcattggtagtcattgtgtagattcgaaaaagcactgaaatgacacagccccagacag
tccaagtgtccttcaggcatagcttactaaatggtgctggccttaccaactgctgtctct

Exon  3 +       4233       4324   0   Internal     92    66    Marginal
gttgtagaacacatgtccccacaatgttaaattgctgagtttgtcaacagttctcagttt
ttgtacttagtccatcttgcagacctatgccagtttgtgggccacatagtggtactgact
ctttttttacatgtgctcacgacatggtattttgttttgtgttgtgtcgttgctttgtag
AATTTTGATAAGCTGAATGTAAGGACAACACACTATACACCTCTTGCATGTGGTTCAAAT
CCTCTGAAGAGAGAGATTGGGGACTATATCAG
gtaagtgttgggaggaggcactgtgcaaacttactttcttttgaaaatgctttcacatca
gctattcaggaaggcagtggcatgccagaatagctttgtcttgaatatataacctgtacc
cgcagtgaattatttttctttttaacttttcagatttgttgtttcactggagcattaaga

Exon  4 +       4542       4726   2   Internal    185   100   Excellent
cttttgaaaatgctttcacatcagctattcaggaaggcagtggcatgccagaatagcttt
gtcttgaatatataacctgtacccgcagtgaattatttttctttttaacttttcagattt
gttgtttcactggagcattaagagtgggtgatacattaattttttttttttccattccag
GACAGGTTTCATTAATCTTGACAAGCCCTCTAACCCCTCTTCCCATGAGGTGGTAGCCTG
GATTCGACGGATACTTCGGGTGGAGAAGACAGGGCACAGTGGTACGCTGGATCCCAAGGT
GACTGGTTGTTTAATCGTGTGCATAGAACGAGCCACTCGCTTGGTGAAGTCACAACAGAG
TGCAG
gtatgtgggagagggagggaaggactggctagagtgaaaagctttctgtatttcccttct
atgttttgtctgctggaaactatttcttcattaagaaaaaaaaaaatcctaaagcaagga
tattgttttggtttctgtgtacgttctgtcccctgccagatcttggtggtccgcgctttt

Exon  5 +       5323       5387   1   Internal     65   100   Excellent
gtgtcttcattctttcccacatcatcaccatgaaatctctcttaatgcaaattttataga
aacacaaggtcaaactgccgcttttcctgctgtgcaaaatgggagtgactgagcatataa
gaaatatggaaaacagaaaactcagtggccacacctgactactcttttgtcatttttcag
GCAAAGAGTATGTGGGGATTGTCCGGCTGCACAATGCTATTGAAGGGGGGACCCAGCTTT
CTAGG
gtaagtctgcaattgtagggaggacaccctttgttgacttggatctctgagcccctaaac
atctggagatgggttagctgtcctgactgactccttttgtccccttttcagtcggctgct
gcagccagcctggaccagtgactgcacatgtacattctgatgaggtgtttgttttcattt

Exon  6 +       5582       5708   0   Internal    127   100   Excellent
gtagggaggacaccctttgttgacttggatctctgagcccctaaacatctggagatgggt
tagctgtcctgactgactccttttgtccccttttcagtcggctgctgcagccagcctgga
ccagtgactgcacatgtacattctgatgaggtgtttgttttcatttgtgtttgttcttag
GCCCTAGAAACTCTGACAGGTGCCTTATTCCAGCGACCCCCACTTATTGCTGCAGTAAAG
AGGCAGCTCCGAGTGAGGACCATCTACGAGAGCAAAATGATTGAATACGATCCTGAAAGA
AGATTAG
gtgagtcattaggcctgtgagtgggtatgaacacattcttcaggattctgttctcttatt
aaaagtagatgcccttgaagttgaagactttctaaaacctgccctacagctgggatattg
tctgtgggcgatagtttttgttatcttttgttgaaaaagtgaacagtgcctagtaaagtg

Exon  7 +       7493       7636   0   Internal    144    98   Excellent
ccgtctcaaaaaaaaaaaaaaaaaaaaaaaaaagatgcctggaagagccaggactgaaga
ggctgaagacataatgagcttggactagtaaacaagtgacattcagttttaggaagtttg
gggtctgatgggctgagatacaaataaactgaattattttcatacatggctgcttttcag
GACCACATGGTGACAATGCATGATGTGCTTGATGCTCAGTGGCTGTATGATAACCACAAG
GATGAGAGTTACCTGCGGCGAGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAA
CGGCTGGTTATGAAAGACAGTGCA
gtaagttccgggttaggagtttatatttggaaagaacgtactccaaagatgaggcttgct
ctttttattgttttccttgggttttattttatttttttcaagtccaaaccaagtatatta
atttaaagtaaaagtttaatggtaggcatacttaaaaataaggcacattaggccaggcac

Exon  8 +       9085       9217   0   Internal    133   100   Excellent
atagcacagtgaggtggctcttctgagtaccactcatgccccttgcagctagtgggctat
aagtgtcatccctgtttcctggtgtcaggccccactcccttgttgtcctcctttactctg
gtgtgggagtggggtggagggcagcagctgggccccttacacttggtgccatctctgcag
GTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCTTCGATATGAGGAC
GGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAAGGAGAAGCAATCTGCATG
GGTAAGAGGGGAT
gtttattttttaaattctaaatgtttgtggttacatactaggtgtatatatttatggggt
tcatgagatgttttgatacaggcatgcaatacataataatcacatcatggagaatggggc
atccatcttaagcatttatcctttgtgttacaaacaatcctattttactgttagttattt

Exon  9 +      11457      11575   1   Internal    119   100   Excellent
ctccttctcataatggagtatttcctccatatgcacatcctgagcaaaggtaaccccaat
taaagtagtagctcagagttttaaaagttttaaagtggcatacaacagtagaattggggc
tcatcaattatcaattctttcacccttcaaataattcttttctttattcaatgcctgtag
CTATTGCATTAATGACCACAGCGGTCATCTCTACCTGCGACCATGGTATAGTAGCCAAGA
TCAAGAGAGTGATCATGGAGAGAGACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAG
gtaagtggtactgggttgcgtgccctgccaggttcttttttttttttttttttttttaaa
tttatttttttattgataattcttgggtgtttctcacagagggggatttggcagggtcat
gggacaatagtggagggaaggtcagcagataaacaagtgaacaaaggtctctggttttcc

Exon 10 +      12928      13031   0   Internal    104   100   Excellent
tgatcttcaacaagtcctgtgtgtgttggagttagtgggcaaattctgaatgctctggag
aggagtttgaggccctgctgagaatacaccagggaggaaccttgttctattctttgtagt
caccatgcccgcttccagcattgacaccattctaatgttgacaccttgatgttccaccag
GCAAGTCAGAAGAAGCTGATGATCAAGCAGGGCCTTCTGGACAAGCATGGGAAGCCCACA
GACAGCACACCTGCCACCTGGAAGCAGGAGTATGTTGACTACAG
gtgagggcaggatgtttcagagccggggtgggtagagacggcacacttgctgccttgatg
caggagtatgtcaacaacaggtgaggatgggaaggtagagcccacttgccatctggacgc
aggagtacatggacaacaggtgaggaacaggtgagcatggaggttgtagagcccagggga

Exon 11 +      13841      13897   0    Initial     57    47    Marginal
gcattcgtcttactttgtgactgtccgcagtccagccatatacgctagcatcagaggtgc
agcgcatacacaggtaatgctgcctcataccctggggtgcttgtttgggctctgcaggct
cctctgatttgtattctctgtcctatctgctgggaggaggaatgtgggctcaggaatcag
ATGGGCCTCGACTCCTACCTCAGCTATGGCAGCAACACAGTGATGGAATGGGTGGTG
gtgtgtgtgtcaattctggcccccgccctgggtcaaatggtaggacagatgtgttgaaat
cagaggccatggctgttggacattcgaggccatacaaaattcagcagagagcagaattgc
atcttaacctggcaccacccagtgttgaaagagtcagtcaagcatgggttggcaactcca

Exon 12 +      14513      14650   0   Internal    138    93   Excellent
gggatgagactgtcttcaaatcctcagtaaactaaggccctgtccgggtttgtagtcaga
aaacgtcctgttagattcagttgggatctttcttggtgccttgctaccttttgactcact
gaacctttcttgtccattattgcccaagatctaacacttaaccaattgctttcatctcag
CGGAAGCGAGAGAGTGAGAGTGAAAGTGACGAGACTCCTCCAGCAGCTCCTCAGTTGATC
AAGAAGGAAAAGAAGAAGAGTAAGAAGGACAAGAAGGCCAAAGCTGGTCTGGAGAGCGGG
GCCGAGCCTGGAGATGGG
gtgtgtggaaacacgttcaggttccttgggctggcttagtccctgcgtggggaaagaatt
acccaggtggtaccagctttgttactcttcttggaggagctgtggcctgggggtgggatg
ccaccgagtgcctttagtgcttccccatgttcctggagtgcttttgccctccctgtggaa

Exon 13 +      15125      15193   0   Terminal     69    95   Excellent
ctagggtgtcactgaaaggtttacagaactttgtgtcacatgcagcatttaacccaaaat
atccttacaggtcctgaaaaaggcttgcttgactgtggacctttaccagatttccttctg
ggagagtcatagctttgttagtggatggtatctgtgagctttcattctctttctttctag
GACAGTGATACCACCAAGAAGAAGAAGAAGAAGAAGAAAGCAAAAGAGGTAGAATTGGTT
TCTGAGTAG
tgaaggccacttgaagctggaggagaaactaaagccttattgagaaaacatgttatagat
ccttttgttgctgagagagtggaacataggtcctagacagggtgaagagttctggcacat
tttagctgctactttgagacctcggtgatgttacctggtgtggtcatcccatcttgtcct

--------------------------------------------------------------------------------