--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (39140 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      11659      11800   0   Internal    142    51    Marginal
gctcagtcagtgggtgtgggcaaaatcagttgggcagcagttagtgtgtgtccagaactg
caggtgcagcctccatatccttattagttcccttggttacagaccccagtgggacaatgt
ttgaaaaattatattcaccgtctaggaaattgggaactgaaagtccaatatctgcctcag
TGGAGTTCTGGCACCTGCATTATCCCTTCTGGGTATATCAAGATCAACAGCTGCACAGAT
ACTTTTGCTTTTCACAGATTCTACACATATCATATAAAGGTGAATAGTGTAAAGCTACCT
CTACACCTTACCAAGCACACAG
gtgcgtgccatttaacatctagagcattccattgccttatacaagaactcagtttatatg
agctcacaacatcgaaccaatccccccccaattcagtgtgcatccattatacctgaaacc
tgacagagctgggggctgtgggaggaggttggtaggaagaaattattttgtgagctgtgc

Exon  2 +      12081      12251   0   Internal    171    79        Good
catccattatacctgaaacctgacagagctgggggctgtgggaggaggttggtaggaaga
aattattttgtgagctgtgcacatttttgttccatttgaaactaggtagctaggctgagg
gggaaccaagagggatgaggattaatgtcctgggtcctcaggaactttcattatcaacag
CACACAGGTGAACTCCAGAAAGAAGAAGCTATGGCCGCAGTGATTCTGGAGAGCATCTTT
CTGAAGCGATCCCAACAGAAAAAGAAAACATCACCTCTAAACTTCAAGAAGCGCCTGTTT
CTCTTGACCGTGCACAAACTCTCCTACTATGAGTATGACTTTGAACGTGGG
gtaagtttctcgactatgaaaactgagtttcaagatatcaaggacttggccttagatctt
tcttggggaagaggtaaattttcgttggtaggaggaggggagtagaatggacctaagttc
tttcaaattcagcaaaatatttcctagcctataactagctaaagccggaaagtcaaaggt

Exon  3 +      12761      12859   0   Internal     99    96   Excellent
atttgccctccatttggtagtcatagatttatagatctggaaggatttttttttcttccc
ccacatgacaggtcctggtgccacctcactttgttgaatgattagataacaaaatctaat
catctggttgcttaatccctcttaatctttctccattttcttcctcattctacttctcag
AGAAGAGGCAGTAAGAAGGGTTCAATAGATGTTGAGAAGATCACTTGTGTTGAAACAGTG
GTTCCTGAAAAAAATCCTCCTCCAGAAAGACAGATTCCG
gtaagaagagaccaatgtctgagatggggaacagcagatttgaagaaatttgcaacattt
aaattctctgtaaatagactggtgatgctgtgcaacgtggaacacggtcaagtttccttt
aaaaattcttcactctaccatattggttataaagaatcttagcttctttccttcatattc

Exon  4 +      15694      15762   0   Internal     69   100   Excellent
tatgtgttgggtcgtattggatatgtgtccctattggcctatagaaagtaatcactaaga
atcagccttgtctgtgcaggagaaacttctgaagccacagcaaaaggcttctagtaccta
aggaaattcagaaaagagcaatgcatcaaccaataaccattttttcttatttcattacag
AGAAGAGGTGAAGAGTCCAGTGAAATGGAGCAAATTTCAATCATTGAAAGGTTCCCTTAT
CCCTTCCAG
gtgagttattttctctcaccaaatctcgaaaggcccctgtaacacaattagaaggggtgg
tggggtgcagggcagagggaaggctacgaggacccagtgaatagaagttgaggtggacaa
ggatgctgaaccaagaaatgagactggcatgggctaagaatgtttgcttttctatttacc

Exon  5 +      17316      17517   0   Internal    202    83        Good
aagagttcaggaatccttcagatagttcacataacctgaacaccattgctgactgaagat
tctgcctttctttgttttctacaataaatatacaaattgtcccctaagattagtactttc
aaggtctttctccttttttctgaatcctaactgctgaagtctgtgttttcatcgacccag
GTTGTATATGATGAAGGGCCTCTCTACGTCTTCTCCCCAACTGAAGAACTAAGGAAGCGG
TGGATTCACCAGCTCAAAAACGGTGAGAATTATTTGGAAAATAAATGTTTCCAAAGAAAG
AAGGAAAGGAAGGAAGAGGAGATAGACGGGAGGAAAAGGAAAGAAGGAAGAGAGAAACGA
GAAAGAAAGAGAAAGGAGAAAC
gtagagagaaaagaagaaaaaaatggatagaaggggagaaaagaaagagagagggagggg
aggagggagacaggaaggaaggaagcaaggaaagaaggaaggggatgagggaggaaagaa
agacaaataacaaagaaacaaaggaaagtttgtattttgtttcaatattagtaatacaat

Exon  6 +      17935      18070   0    Initial    136    76        Good
agttctatcactatctctctagtgcaattttgtaattttaggcacctccatttctctatt
tattaagaaaagtcccattttttgcactgaatacaagggtggtgtggcattcaatggtta
tgcaatatttagaatcctaagtataaaatacctagctccaaaaaattaaatagatgatgt
ATGAGAGTGCTTGAAGTCAGAGTCAGAGAACCTGGTTTCAAGCCCTCTTTTACCATTTAC
AAACTGGGTGATTTCTGGCAAGAAGGCCAACAAGCTTCTTTGATGCTCAGTTTCTTCTTC
TCAAAGGAGAATAATG
gtaattcatgccacatctacctctggggttgttgtaaggatcaaatgaagtaataataca
tgtaaaagcacatggaaaactgtaaatcactgtatacgaaagcactgtacatctctttgt
tgtggataaatatttcccaaggaaatatttcatattccttgctttgtgaggacctaaact

Exon  7 +      18848      19010   0   Internal    163    77        Good
cttttatatattatctcatttaattttcacaacaaccttggcctaaaaacaacaacaatg
ataactaacacttaatgagcacttactatgtagcaggctctgtcccaagtgcttcaaatg
tattacttatttgatctttgcagtagccttaagaagtatgtattattcccctatttacag
ATGAGGAAACTGAAGCTCAAAGATGTTATGCAACTTGCTCATGGGCACACAGTGAATGGT
GGAGCCTGGATTCTTATCACATCCCTGTGTCTGTATGACTCCAAAGCCCAAGCTCATTGC
ATAGTTTTGCGCTGCTTGGTTTCCAAGTCCAGAAATTTCACAT
gtagttggttgcaaaatattctatagtaaagctatgttgaatattacaaataggtgatat
cctgcaatacacagttcagttcttggcatattttaagataaggggtctgctttagccctg
gggctacaaaatgagcaaactctttaatactgcttattgtgatacaggctcttctttaag

Exon  8 +      24706      24834   1   Internal    129    69    Marginal
cagggcacagtcaggcaggccagtcatgtgagccaactggtcctgtgatctgctctcctt
cagggtggccaaggagggggcagttgcttgaagttcaccactaagctcaaagaggaaaac
atgcaaatggtggcttctcctccatgtcagatgtgatctctctcttctttcctgctacag
TAATCCGGTACAACAGTGATCTGGTTCAGAAATATCACCCTTGCTTCTGGATCGATGGGC
AGTATCTCTGCTGCTCTCAGACAGCCAAAAATGCTATGGGCTGCCAAATTTTGGAGAACA
GGAATGGAA
gtaagcaatctgatcgatataatttctttctcctttgactgtttccatcactctcccaag
ggtctgtcaagcccagggtcatagcataaggttgtacactttgggtgctaaacaaagggt
cctgggggagggaggaggcacatgggggctgaaatccagctggtaatctgctctccaagc

Exon  9 +      26640      26827   0   Internal    188    76        Good
tatatgtgtgcaaggctgagaactcctgcactggtgcttaaaaatggttgttgaatgact
gctgagtaatattttagtatgcctgatttgggtgtcttgagtaagccagagagttgggag
agaagagaagagtgcttggtatcttgacaaaccctcctaccttttctcctaactacatag
ATCTTGAAAAAGCCACTACCGCCTGAGCCAGCAGCAGCACCAGTCTCCACAAGTGAGCTG
AAAAAGGTTGTGGCCCTTTATGATTACATGCCAATGAATGCAAATGATCTACAGCTGCGG
AAGGGTGATGAATATTTTATCTTGGAGGAAAGCAACTTACCATGGTGGAGAGCACGAGAT
AAAAATGG
gtgagtccacaccagcccttcctgagcctggtgcctgcccactccctacacgcaaaaagt
gctgcggcataattcccgtgatcagcatcctcatcagagactgttcttcccacaccagac
tgaacatgctctccctccaagtacttcccagcgtgcagctccctatacatggcctctgcc

Exon 10 +      27245      27307   2   Internal     63    81        Good
ctgcacctcactggctcactgcctaaccatgcatcagagacatgattgtctttgagggag
gtgcatgatacatatacctccatttgagatttgttctgagctcagggacgtgggcatatg
aatctgtctcctggaggctggggaggtgctggatgaactgccacattgtttccttcacag
GCAGGAAGGCTACATTCCTAGTAACTATGTCACTGAAGCAGAAGACTCCATAGAAATGTA
TGA
gtaagtatgtttatgtcagtccacaatcttccaggaggaactctctctctctatatatat
atatatttatttatttatatatattttatatatatttatatatatatataacacacacaa
gtgtatatatgtatacatatgtatacatacactggtgtatatataggtatattatgtata

Exon 11 +      28048      28102   2   Internal     55    50    Marginal
tcttcaatgccaacctgggtttgggaaagggatacagtgtgctatgcacatgacagatgc
tcagtaaatagggtttgagtgagttgactgaatcactgacatggacaagccctggagggt
gctgtaacctccaatctgcttatgaccaggagccactcaagcagcactctcccttcacag
GTGGTATTCCAAACACATGACTCGGAGTCAGGCTGAGCAACTGCTAAAGCAAGAG
gtaagtgtggaaccactagcacacagcattctccttgcataagtgaggatcttgaactga
gggcctgttctgccccctacctttgggcaaggcagtgtcaaagctgccatcgtctgggat
cccaattacaccattttttttgtttttgtttttctgagacggactctcggtctgtcaccc

Exon 12 +      28699      28778   0   Internal     80    78        Good
catgagccaccatgcccggcctgcaccttttaatattaaaagcaatgaggctgtagctca
agcgtggaacttggcagtaaaatcaggggttgttctattttctctctcaagtttgggcag
gtgggatgcaggtgtgagcaccacttcctcctacagacagcttctttttcgttgtttcag
GGGAAAGAAGGAGGTTTCATTGTCAGAGACTCCAGCAAAGCTGGCAAATATACAGTGTCT
GTGTTTGCTAAATCCACAGG
gtgagtgctactattccaaggccctgaggacaaagaacaggggtaccctcctaatagctc
cttgatgctgtgcccgtcccacttcctctgtctctgaaactcaaaactcatctcacttca
cttcctgggttctgttgacctttgtgcccaagttactgactaagcatccacttcttcagg

Exon 13 +      28958      29085   2   Internal    128    88        Good
ggtgagtgctactattccaaggccctgaggacaaagaacaggggtaccctcctaatagct
ccttgatgctgtgcccgtcccacttcctctgtctctgaaactcaaaactcatctcacttc
acttcctgggttctgttgacctttgtgcccaagttactgactaagcatccacttcttcag
GGACCCTCAAGGGGTGATACGTCATTATGTTGTGTGTTCCACACCTCAGAGCCAGTATTA
CCTGGCTGAGAAGCACCTTTTCAGCACCATCCCTGAGCTCATTAACTACCATCAGCACAA
CTCTGCAG
gtgagtaccaggggcaactgagaagggagttacagacaccaggataagcaatgcaggaca
aggtgataagaggaagaatctgcctcacaggacagtgtgaattcactgtgaaaggaaatc
cctgtgatactgggtagaagctggtaaagaggtggtcagaggcagacctacacccaacag

Exon 14 +      30368      30611   1   Internal    244   100   Excellent
ataatcataaagggatttggggaggttgcttagtctatcttcttgccttatggccacctt
gaacctaaaattcccagattcctctaaccaatgaatcccgtttctgagattgacttaagc
aaagacagattagtacttctaaaaatttcccttttactagttttcctatttctaccccag
TAGGGATTTTTGTCTATTGTAAGAATTATACATTCATGACCCCAAAGAATCACACCAAGA
CTTTATTGTTAGGATCATGGGAAATTGATCCAAAGGACCTGACCTTCTTGAAGGAGCTGG
GGACTGGACAATTTGGGGTAGTGAAGTATGGGAAATGGAGAGGCCAGTACGACGTGGCCA
TCAAGATGATCAAAGAAGGCTCCATGTCTGAAGATGAATTCATTGAAGAAGCCAAAGTCA
TGAT
gtgagttatagcccaaactcaactctcaatctatttgctggagtctaggaattcacacaa
caacccactgaggcttaaagatgacttacagtaagagaggtttgggacgagggactgaag
tttacctttaactggcggtagtcctaagtgctaagataatagtttctgtgccttagatat

Exon 15 +      31127      31324   2   Internal    198   100   Excellent
cctgcttgcttccacattttaagcacttttgagatttagggtgggaaagaggaaaataaa
cttgctggtgtgaccccttatctgatgctctactcctaggtcagccccttcctccccagc
ccctttattgctattatgcagagccaaaaggagaagactagttccttgcctttcctgtag
GAATCTTTCCCATGAGAAGCTGGTGCAGTTGTATGGCGTCTGCACCAAGCAGCGCCCCAT
CTTCATCATCACTGAGTACATGGCCAATGGCTGCCTCCTGAACTACCTGAGGGAGATGCG
CCACCGCTTCCAGACTCAGCAGCTGCTAGAGATGTGCAAGGATGTCTGTGAAGCCATGGA
ATACCTGGAGTCAAAGCA
gttccttcaccgagacctggtgggaccttagaaggattggcctaggacaaagggctgatg
gggtggaagtagcagtggaagatatatcatacatggttgaggggggctgctggtgccatc
atttcaattttatctagaaagtactataagttaggcgtgcctctgccccagtgctgagcc

Exon 16 +      33407      33525   2   Internal    119   100   Excellent
aatcagatacaaaaacaggaaattcgttaaaagtaacgtttgtagaagatactagttgag
gaggagagacttttgagaaagcctgtgtgtgtttgtgacactcttgtgaccgtgccaaga
aaacgtaagcaaatatcaagcctccaaatcctaatgcaacaagtcctgaatcccttgcag
GTATGTCCTGGATGATGAATACACAAGCTCAGTAGGCTCCAAATTTCCAGTCCGGTGGTC
CCCACCGGAAGTCCTGATGTATAGCAAGTTCAGCAGCAAATCTGACATTTGGGCTTTTG
gtaagtggataagattacacagattatacagctcaaaggataagaaatgcaatgggaaaa
ttcacactttgcaacctccacagagatattgttcttgctttcattcttccaatccttggg
gagtgcttactgtgtgtcagccaccacaggggtttctgaggatgaaaactaaactggaca

Exon 17 +      34044      34201   1   Internal    158    93   Excellent
tagtacgaccttgatctccatctagtgtggtcagtactatagcagaaatttgggcaaaat
ataaaaagcacagagcggggaaccaactgattctaatctttgaggttgatctaggaagac
taggacccctgctatccaaaaagactgcaaaccaatttaataatttttttcaccttctag
GGGTTTTGATGTGGGAAATTTACTCCCTGGGGAAGATGCCATATGAGAGATTTACTAACA
GTGAGACTGCTGAACACATTGCCCAAGGCCTACGTCTCTACAGGCCTCATCTGGCTTCAG
AGAAGGTATATACCATCATGTACAGTTGCTGGCATGAG
gtaagtgctttattaggatctcttaaattatttccttgaatctacttgcccatttagctg
gccattcagccaccaaagactgatagctgcacacattcttttttttcctttttttttttt
tttaatttgagacaaggtctcgctctttcacccaggttggagtacagtggcgcgatcttg

Exon 18 +      37439      37510   0   Terminal     72    87        Good
gcacaaagactttatggagagctgctatttcttttttttttttttttccttttgtaatcg
acagggcatgctactgggcatagagcatatatttaataaacatttgctgcttactcattg
catttcccttgaattctggattctagccactctaacactttactttttctttggttttag
AAAGCAGATGAGCGTCCCACTTTCAAAATTCTTCTGAGCAATATTCTAGATGTCATGGAT
GAAGAATCCTGA
gctcgccaataagcttcttggttctacttctcttctccacaagccccaatttcactttct
cagaggaaatcccaagcttaggagccctggagcctttgtgctcccactcaatacaaaaag
gcccctctctacatctgggaatgcacctcttctttgattccctgggatagtggcttctga

Exon 19 +      38731      38862   0    Initial    132    79        Good
gaacgaagcaccggcgccaaggtgtgggaggcggcggggtggagttggacgcctgcctcg
cgccgacgcagtgcactcacgggggcggtcccagaggcagctagctgtggttccggttcc
gtcgcggagacacgtgaaggtcggtgcggagttcgtctctgcaagcttggtcgccctggg
ATGGATTCCTCCTCCTCTTCCTCCGCGGCGGGTTTGGGTGCAGTGGACCCGCAGTTGCAG
CATTTCATCGAGGTAGAGACTCAAAAGCAGCGCTTCCAGCAGCTGGTGCACCAGATGACT
GAACTTTGTTGG
gtgaggagcctggggctgggacctgaacactgtacctactttccctctgtccttgtaccg
cgggactcgcgacaacgtcggggattcggggtggggggcgggcacctggcagcaaccctt
gattttctcaggttcctgtggcctagccggatgggagaagggtgactccgcttctctggg

--------------------------------------------------------------------------------