--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13962 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1396   0    Initial    196    71        Good
ccgcgggcagggcgggagccggcagccggcaaccaagggaggcagaaaggcacaaagatc
gcaataatatccgttataacccgctatctaaccccacccccaacacacacccatccatcc
caccctccgggagaggcagccggcgatccgctctctgcgccctgggaaaaagccccagcc
ATGAGCAATCAGTACCAGGAGGAGGGCTGCTCCGAGAGGCCCGAGTGCAAAAGTAAATCT
CCAACTTTGCTCTCCTCCTACTGCATCGACAGCATCCTGGGCCGGAGGAGCCCGTGCAAA
ATGCGGTTGCTGGGAGCCGCGCAGAGCTTGCCTGCTCCGCTGACCAGCCGCGCCGACCCG
GAAAAGGCCGTGCAAG
gtaaggatgctcccgtcaggcacttactaagggcattgggccctgatttggatgtttggt
gttcgggggccagtggcctggaattgtcaatttggagaggaaggaaggagagggcataac
tctgaggcctgctgcctcaaagagcgttaaacatctagccagggctgtctctccctccct

Exon  2 +       2493       2584   1   Internal     92    62    Marginal
ctgcgcctgctgcactcccactccctctctgccccagacctttcccagaacatttttgcc
aggatgatttttctttgcctttttgtgcaagaagcccccccaccctctcccgctgtgggc
tgttggggcgcggcctgcacttggggccacagggccgctttcccccaccccgccccgcag
CGGTCGCCTTCAGGGCTGCACCCCTCTTGCCAACCCTTGCCCTCATGGTGGAGCAGCGGG
CAGAGGTCATGCGCAAAGTTTTCAGGATAGTG
gtgattttcttttaaagttgtagaatgttttcggattttcctctgccccgacgtgggaag
ggaaataaaaatgagagagtaggaaaggggaaagagaaaggaataaagaagaaagaagga
gagaggggagagaaagcctgcaaaaagagaaagaaagggggagagaaggagaaagagagg

Exon  3 +       3046       4016   0   Internal    971    87        Good
aaataaaagggggagagtgagagagggaacggaaagaagggagaggaaaggggaaaaaag
aaggaacccagagaaagggagaaggagagaaagaaagaaaaagaaaaagcaagaaaagtg
gagaaagaggccaaggcgtcgaagtctggtggtgcgcggtccccgcacgcctgggcctag
GCACTGGGGGAGCAACTGCGGGCGGGCCCCGGCAGCAGCCCTGGCTGGGACTCCCCGGCC
GGCCGGCTGGCTGATAGCTCTCCCTTGCCCGCAGGCTCCCCTAAGAGCAGCAGCGCCCCG
TTCGAGGCCGAGCTGCACCTGCCGCCCAAGCTGCGGCGCCTGTACGGCCCGGGCGGGGGC
CGCCTCCTTCAGGGTGCGGCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCAGCGGCC
GCCACGGCCACGGCGGGTCCACGCGGGGAGGCCCCTCCGCCGCCACCGCCAACCGCGCGG
CCCGGGGAACGGCCGGACGGCGCAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGCCGCG
GCCTGGGACACGCTCAAGATCAGCCAGGCGCCGCAGGTGAGCATCAGCCGCAGCAAGTCG
TACCGCGAGAACGGGGCGCCCTTCGTGCCGCCGCCGCCCGCGCTGGACGAGCTGGGCGGC
CCGGGGGGCGTCACGCACCCGGAGGAGCGCCTCGGCGTGGCCGGCGGCCCGGGCAGCGCC
CCGGCTGCGGGTGGTGGCACCGGCACCGAGGACGACGAGGAGGAGCTGCTGGAGGACGAA
GAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGAC
GACGCCCGCGCGCTGCTCAAGGAGCCCCGGCGCTGTCCTGTGGCCGCCACTGGCGCCGTG
GCCGCAGCAGCTGCCGCTGCAGTGGCCACAGAGGGCGGGGAGCTGTCACCCAAGGAGGAG
CTGCTGCTGCACCCGGAAGACGCTGAGGGCAAGGACGGCGAGGACAGCGTGTGCCTCTCT
GCGGGCAGCGACTCGGAGGAGGGGCTGCTGAAACGCAAACAGAGGCGCTACCGCACCACG
TTCACCAGCTACCAGCTGGAGGAACTGGAGCGGGCCTTCCAGAAGACGCACTACCCGGAC
GTCTTCACCAG
gtatgcgcgtagggtggtcgcggtcgcagcggcagagagcgcacgcgggccccagggagg
gacagcgggctggcaggggccccggcctcggggcggacgcttggctcctggactctgtgg
aagagcgccctcccaacacacccacccttgctcacccaaactacccactcccccgacccc

Exon  4 +       4505       4608   1   Terminal    104    55    Marginal
cccgaaagcgccaccttggagacgcgcgcacagcagagggcacagacacaaggcctccgg
agctgcggtcccggctaggtccccggcgaggctcaggaagcgctgtccgcagacagagca
aagcaggggctatttttggtcgctgtgctgtgcgctcgccacccccgcctggtgccccag
GGGCCTGGTGGGTATCAGTTACGCAGTTCGCAGTGAAGCTGGAGCCCGTGCCAGCGGAGA
AGGCCTTTAAAAAGATCCGAGTTCTGTCGTTTCAGGACTCCTGA
aataaccaaaggaagtcagaactgggcagtgtttggtgtctgaacacctgaggggcccca
gccagaatctccccttctactctctgtcctctcccgacacacatattaaacccaccgtgc
gtttaatgtaaacgggtttaccgggtggacaatgattgctggaagcctggcagggagtag

Exon  5 +       5586       5721   0   Internal    136    53    Marginal
accagcgttttgcgtttatcgtacgtgtgtatttccaaagaagaaactgagctggtgtca
gttggcatccacgtccgccctttcttagcttctggcgggcttaggggcgggggaggaccg
aagtgcacgaggaggggcagctcctcttccccgccccacccccacctctttccaacccag
GGGTTTGAGCCCCTTGGCTCCGGCCCTGAGCCAGCCTGGAGTGCCGCTTTAGATTTGCTG
ATGCCCACTGTAGCTGGGGGCAACGGCAACGGAGGGCACTTATGGAGACGGTTTACCTCT
GGTGCTGAAGTTTCAG
gtgtggactgggggcctaccggcagggcaaccccaggtcccaggcttcggcggccccgct
ctttcatattagcgagccggagggccaattattctcggcgcggtcatattttcggtaaac
aggttgtaagccgttttacagcatcttaatggtttcctatttgccttaattgtcgcagta

Exon  6 +       6633       6678   2   Internal     46    97   Excellent
tcagtcaaatagttggcactccagggggtgatggaatggtaatgcccatatgtttggggg
tggggggcaggcagccaggggagaccctggtggagtaggcctgccatagaggaggaaata
gctgagagggcattgctggggcctgcagtgacctcctgtctgtgtgttgctttcttatag
GGAGGAACTGGCCATGAGGCTGGACTTGACCGAGGCCCGAGTCCAG
gtgagctgcacaacagagggaagagggagggaggagggctgggggccagtgggagagaga
gagatgggttggtggcgggggggtgcggggggtgagatccccttcacaaaaccaagagaa
gcaggatcagaaaagtagacccaagcactctctcacacacaaagatatttaaaacttaag

Exon  7 +       9499       9827   0   Internal    329    66    Marginal
cactgctcatttggccccagacgcgtccgaaaacaacctgaggccaaagaggggcaggtg
ggcgcgggccgcggtggaaaggaagggggccccgcagcgcgccaagggaagggacgggta
ggggcccggtgcgcccgccgggccgagccgcgccgaccctgggctctctctgccttgcag
GTCTGGTTCCAGAACCGTCGGGCCAAGTGGCGCAAGCGGGAGAAGGCAGGCGCGCAGACC
CACCCCCCTGGGCTGCCCTTCCCGGGGCCGCTCTCCGCCACCCACCCGCTCAGCCCCTAC
CTGGACGCCAGCCCCTTCCCTCCGCACCACCCGGCGCTCGACTCCGCTTGGACTGCCGCT
GCCGCCGCCGCCGCCGCCGCCTTCCCGAGCCTACCTCCGCCTCCGGGCTCGGCCAGCCTG
CCGCCCAGCGGGGCGCCGCTGGGCCTGAGCACTTTCCTCGGAGCGGCAGTGTTCCGACAC
CCAGCTTTCATCAGCCCGGCATTCGGCAG
gtaacgcgcagcctcggaagtctgtctgtctgtctgtctctcatacacacagaggctggg
ggcagggaggaggcaggagtcaaacagggttacacacatctttttctttgacccaacctc
agagactgtagccaaagaaaatactctctaattgagcctcaaaaaaaaaaatgtgggtct

Exon  8 +      12041      12268   0     Single    228    86        Good
ggtccagcttccgcccgcgccctctgcccacttccccgccgcggcccatccgggtcccgt
gggtaccgcgcccctcagctgccccggcgacaagcggcgggagacgctgcccgaggcgcc
gcgcacagctcccgaggccatgaccgcgctgtttgctctccctgcaggctcttttccaca
ATGGCCCCCCTGACCAGCGCGTCGACCGCGGCCGCGCTCCTGAGACAGCCCACACCCGCC
GTGGAGGGCGCAGTGGCATCGGGCGCCCTGGCCGACCCGGCCACGGCGGCCGCAGACAGA
CGCGCCTCTAGCATAGCCGCGCTGAGGCTCAAGGCCAAGGAGCACGCGGCGCAGCTCACG
CAGCTCAACATCCTGCCGGGCACCAGCACGGGCAAGGAGGTGTGCTAA
aggctgccctccacacccgcgccccgcgcgcgccccgaaaggtcacctcactcagcacca
ctcaagaccaaatggaaacagaggaccagcacactcccgagacggcactgagagagcgca
gccgccttcacagcagtctggatgcgggcatggcagccctcggcgctccgggacgtggca

Exon  9 +      12684      12760   2   Internal     77    60    Marginal
cgctccaactccaacatccactctctcttgttcttactttcctgaaaatatcggggaggt
tttctcccccagacgcctgatattgaagtaaaaaatttaaaaagcccaacctcttcctcc
tgacaccccacttagcctttcttttctttctttctttctttcttttttttttttaaatag
CATTTTGGCGCTCGAAGTTGATCTCCCCAGCGAGGGCCCCAGCGTGAAGCCAGGGCCCGG
GAAGCAAATGCGAGCCT
gtaagatagctaacagtgcacttaaaggaaaggggcgtcttgttcttgttctcttcttta
tcatacaccaaccaaggtttttatatcaaaccaaagggaaataatactctgctagaatat
ggactgttgaagtcaccaaactgtgattattgattctgtacataccattgttattaaaaa

--------------------------------------------------------------------------------