--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (48294 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6431       6564   0    Initial    134   100   Excellent
tcagcagcagtgctcggtgcttggagagagacactcttgagcttcaggagatgcctggga
gatccacgtgatctccaaagacccctgttgtgttgtgttgggaggtggatcctgaatcca
cccagagaagcctgataccaataaaatccctgcttgctttccaggagacccttggtcttc
ATGTCTTTGGTGTGTGCACTCTTGAACACATGCCAGGCACACAGGGTGCATGACGACAAG
CCTAATATTGTCCTAATCATGGTTGATGACCTGGGTATTGGAGATCTGGGCTGCTACGGC
AATGACACCATGAG
gtaaggcggtttcatggccagtcatacgttcgtcagtcgttcaggttcagcaggctggct
gtacggctgcatctatgtgcaaaaccaaatgtatttgttgggacttttttttaagttact
ttaaactttttgatagttttaaattatttagattatgtaatagttttacaattacatttt

Exon  2 +       6578       6654   0    Initial     77    57    Marginal
ccctgcttgctttccaggagacccttggtcttcatgtctttggtgtgtgcactcttgaac
acatgccaggcacacagggtgcatgacgacaagcctaatattgtcctaatcatggttgat
gacctgggtattggagatctgggctgctacggcaatgacaccatgaggtaaggcggtttc
ATGGCCAGTCATACGTTCGTCAGTCGTTCAGGTTCAGCAGGCTGGCTGTACGGCTGCATC
TATGTGCAAAACCAAAT
gtatttgttgggacttttttttaagttactttaaactttttgatagttttaaattattta
gattatgtaatagttttacaattacatttttaataattttaatttgaatctctttcagtt
tttaaacttaagaaataataattgtccatcttcacagggtacacagtgaggtttggatac

Exon  3 +       7808       7930   0     Single    123    44    Marginal
atatatataatatataatattcataataggctgtatgatagagggtagttgtgtgttagg
tactattctaagttctttacacacataaactcagggatataaaggcttctctgcatttga
caaataagaaaacaggcacagagaggttcagcgacttctccaagacttcagagctagtaa
ATGCAGAGCCAGGACTCGGGTCCAGATAGCCATGCTTTTACTATGACCATCCTGGTTAAT
GCTAGAGGCACTGGATGTGCTGATTACCCTGATCTGATCACTATACTATATATTAATAAA
TAA
atatatattatttattaatatatatttaattatacatatataaatattttaatataaata
aatataatataaatatttataaatatatttataaataaaattatatataattataaatat
ataattaaatatataattaataaatatatattataaatatagatttataatatataaata

Exon  4 +      10937      11058   2   Internal    122    67    Marginal
ctgtctctctctctgcctcgctttctgggtctctccctctctccctgtctgtctctcctc
tctctttccacctgtgcctttctgtttgtccttctctgtcttcctctcgctcttcctctc
tgcttcccccgccccccaccttttccttctctccaatacaccttccctctcccccttcag
GACGCCTCACATCGACCGCCTTGCCAGGGAAGGCGTGCGACTGACTCAGCACATCTCTGC
CGCCTCCCTCTGCAGCCCAAGCCGGTCCGCGTTCTTGACGGGAAGATACCCCATCCGATC
AG
gtgcgcaaactggcgggctctgctgggctctgccctcatgttaggatgtgaggaaacaaa
aatgtggcttgaccacgttaacaagtaaaaaagggctgggcacgatggctcacgcctgta
atcccagaacttcgggaggccaaggtgggaggattgcttgagcccaggagtttcaaacca

Exon  5 +      18632      19055   1   Internal    424    78        Good
gaacaaaaaaaatgtggctaagtggcactcggattttttagaggaaggagaatatctctg
ctactttatttttgtgtattagctgattgtttcacgtgaagaatgctcacatggtttttg
caatgtgctggcatatgttgacatattgatgcgtagatgtgtttgtgtgtttggttttag
GCAAATGGCACCAAGGCTTGAACTGCGACTCCCGAAGTGACCAGTGCCACCATCCATATA
ATTATGGGTTTGACTACTACTATGGCATGCCGTTCACTCTCGTTGACAGCTGCTGGCCGG
ACCCCTCTCGTAACACGGAATTAGCCTTTGAGAGTCAGCTCTGGCTCTGTGTGCAGCTAG
TTGCCATTGCCATCCTCACCCTAACCTTTGGGAAGCTGAGCGGCTGGGTCTCTGTTCCCT
GGCTCCTGATCTTCTCCATGATTCTGTTTATTTTCCTCTTGGGCTATGCTTGGTTCTCCA
GCCACACGTCCCCTTTATACTGGGACTGCCTCCTCATGCGGGGGCACGAGATCACGGAGC
AGCCCATGAAGGCTGAACGAGCTGGATCCATTATGGTGAAGGAAGCGATTTCCTTTTTAG
AAAG
gtaagcggaataattacaaattcatgtaataatgataatgatctcttttttaaaaggacc
tagatagatctgtagggtgattgtagtttataataatctattgtacacttctaaatagct
aaaagagaataagtcaaatggctctagaataaagaaaagacaaatatttaaggtgatgga

Exon  6 +      23780      23828   2   Terminal     49    54    Marginal
caagcttagttcattttgtttctcccgctcccttcctctctgattgattttatgaagttt
atagagatggtttcagtagcattaccaaaggggttagggagcagttgaggtgctgcagga
tcatggagtccattctatgcaggatggggcccttgggtggacccactctatcttctgcag
CTTGGAGAAGAAGGAAGCAGGTCATGTCTATGAGAAGCCAAAACAATAG
ttttcacattcatagatattgaaaactcacaagtagtttcattgatgtcttctcaggcac
agtaaggaaactttccttctctttttctcctttcttcacgtgcacacacctctccccacc
acggacgatttcactggcaccagcaagcatggcttgtatggggataatgtggaagagatg

Exon  7 +      23885      24021   2   Internal    137    94   Excellent
tgaggtgctgcaggatcatggagtccattctatgcaggatggggcccttgggtggaccca
ctctatcttctgcagcttggagaagaaggaagcaggtcatgtctatgagaagccaaaaca
atagttttcacattcatagatattgaaaactcacaagtagtttcattgatgtcttctcag
GCACAGTAAGGAAACTTTCCTTCTCTTTTTCTCCTTTCTTCACGTGCACACACCTCTCCC
CACCACGGACGATTTCACTGGCACCAGCAAGCATGGCTTGTATGGGGATAATGTGGAAGA
GATGGACTCCATGGTGG
gtaagtcacaggacttaagtggacagaaactaacgtgttctgataggacaggacacctga
aaactgctcttggtcaacctgtagagtgaagagaattatgcctatgggacagagtggtct
gagacattaatgaggtaatagttgctagcaattgagaaagtcagcaaaaaaactatatgc

Exon  8 +      35476      35610   1   Internal    135   100   Excellent
tttttctctttcaatggtttgtcaatttaaactgttaatgcacatttcttttcttttgtg
gcttttgacatagggtcacaccatccttgttttcctttagatagctcatgcccatttgac
ttaggggtgaaatacctcataatgtcattatttttacttgtctcttgtatattattttag
GCAAGATTCTTGATGCTATCGATGATTTTGGCCTAAGGAACAACACCCTTGTCTACTTTA
CATCAGATCACGGAGGGCATTTGGAAGCTAGGCGAGGGCATGCCCAACTTGGTGGATGGA
ATGGAATATACAAAG
gtgaggagaggaactcatgcaagtgatctggtggtgaataagcttttttgtggttcttat
aattaaagcccatgacacaaaggaatgaggcctgaaaaactgaacaagtttgtttaattt
gactcttagtaaaatgaagtattggaccaaggtcaagaaaattggtcttacatttgttaa

Exon  9 +      38151      38237   0   Terminal     87    70        Good
cagcagcacaggaaaatataattctgtagacgtgcactacttaccccactaggactctac
atagagtagacactatacaaatgtgatctcttttgatactagcttaccttttaaatacat
tcaatacagtgactattttaactaggcacaataattgaacttaattgcattgtcttatag
GTGGAAAAGGCATGGGGGGCTGGGAAGGTGGAATCCGCGTCCCAGGAATTGTCCGATGGC
CTGGAAAGGTACCAGCTGGACGGTTGA
ttaaggaacctacaagtttaatggatattttaccaactgtcgcatcagtgtcaggaggaa
gtctccctcaggacaggtgatgtcatataaactgttaacaagagcttattttcacccttc
ttccttctcagaagattcagaacaaggagactgactctatcctggcagacccactttttc

Exon 10 +      41483      41538   1   Terminal     56    82        Good
gacctcacgtggataccaaaatacccagatgctcccgtccctgatgtaaaatactgtagt
atttgcatattacctacacacatccttttgtatatattaaatcatctctagattactcat
aatacctaatacaatgtatgtaaatgccacataaaatagttgttatattgtaccctttag
GGAATAATGACGAGAAAAAGTCTGTACATATTCAGTACAAACAAGACCGTCCCTAA
aaggaccataagcctaaatgtaaacccaaaattataacacttctaaataaaacataggag
aaaatcattgtaatattcagataagaaaataatttttttagatttatcaaaaaagttgca
agctataaaagaaaaaagtgatagattagtcattatcaaaatttaaaatttctgcttttc

Exon 11 +      44539      44641   0    Initial    103   100   Excellent
atctcccagagagcatgcatgagttttcctaaagactcagtacgctgtcctctggacctg
aggcatgacgcagtcttcaccaagtacccttcaggtagcttgggacccaacgtcccttct
cctcattttccttatctgcactgtctgtgtctctgcagggtcattgacggccgagacctc
ATGCCCTTGCTGCAGGGCAACGTCAGGCACTCGGAGCATGAATTTCTTTTCCACTACTGT
GGCTCCTACCTGCACGCCGTGCGGTGGATCCCCAAGGACGACA
gtgagtgctcaacccgttgcttcctgttccctgccaggagcagggtcactcaggtgtatc
ctgaacgcattcttcctttcctctctagaccggtcctttcattccagggctcactgaaca
catggttttggagaagtttctcagaattgctcttctgcagaaaggcaggtgggggtaatg

Exon 12 +      44749      44809   1   Internal     61    73        Good
tcggagcatgaatttcttttccactactgtggctcctacctgcacgccgtgcggtggatc
cccaaggacgacagtgagtgctcaacccgttgcttcctgttccctgccaggagcagggtc
actcaggtgtatcctgaacgcattcttcctttcctctctagaccggtcctttcattccag
GGCTCACTGAACACATGGTTTTGGAGAAGTTTCTCAGAATTGCTCTTCTGCAGAAAGGCA
G
gtgggggtaatggagatgctaattggcttcacttaattatctcagcagtcgcacatacat
taaaacatcacattgtgcatggaaaatctatgcaatttttacttatcgattacactttaa
taaagaaaacagatgtatgaacataagatttgcctataaagttagagagacacttttacg

Exon 13 +      46705      46945   2   Terminal    241    76        Good
gtgcgcatcatttgacgagtctctcttttctcctccaggtgggtcagtttggaaggctca
ctatgtgaccccggtattccagccaccagcttctggtggctgctatgtcacctcattatg
cagatgtttcggagaacaggttacctaccacaacccccctctgctcttcgatctctccag
GGACCCCTCAGAGTCCACACCCCTGACACCTGCCACAGAGCCCCTCCATGATTTTGTGAT
TAAAAAGGTGGCCAACGCCCTGAAGGAACACCAGGAAACCATCGTGCCTGTGACCTACCA
ACTCTCAGAACTGAATCAGGGCAGGACGTGGCTGAAGCCTTGCTGTGGGGTGTTCCCATT
TTGTCTGTGTGACAAGGAAGAGGAAGTCTCTCAGCCTCGGGGTCCTAACGAGAAGAGATA
A
ttacaatcaggctaccagaggaagcctttggtcctaacgagaagagataattacaatcag
gctaccaaaggaagcactaactttggtgctttcaagttggcaaggagtgcatttaatagt
caataaattcatctaccattccagattattaaaggcccactggttgttccacttgctgct

--------------------------------------------------------------------------------