--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (21267 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1243       1309   0    Initial     67    87        Good
ggagcccctcgcgggcagtgccagccctgggccgccccgccccaccgggagccgcgctgg
gggcggggctgggcggagcccgcgcagggtgctggccgcagcgcccccaagtcccggcgc
cgggcccgctcacggccgcgtgggagcagtggggttcgacggcgcggccgcgaggccgcc
ATGGCCGCTCACGGGAAGCTGCGGCGGGAGCGGGGGCTGCAGGCTGAGTATGAGACGCAA
GTCAAAG
gtgagagggcgccgggcgctcccggcccgtttcctgcggagaacccaaggtcgtgaggga
gctccaagcgtccccgcgctggcccagggcccgatgctctccccagcgacctctggagcg
ggggtggaggagggagcctgagccccttgcctgcctcccgacgcccatttggcctcaacc

Exon  2 +       1577       1685   1   Internal    109    68    Marginal
ggcccgatgctctccccagcgacctctggagcgggggtggaggagggagcctgagcccct
tgcctgcctcccgacgcccatttggcctcaaccgcctgccattttcccttccttctttcc
tgtcttccttcctttggtctctgtcctccttgggtctaccgcttctcacccaaggttcag
TGGAGACACTGGTGGCCGCTGGTAAAAGAGAGCCAGATGCACCCAACGTGCCCCTCAGAA
GGCAGTATTTTAGCTACAGTGAAGTCAACCAGCTTGATTGGGCTGGGGG
gtgagtaagggagtccgggtgagtggattggtggagatcacctggccgtaaccccactgc
agtccctggagcttcagcaccttttgcctccctttagcactgagggggagcagaggcgag
ggccactgtctctgggtcaagctggcgcagtgagtcttggttgagagatttaacagggct

Exon  3 +       5637       5841   1   Internal    205   100   Excellent
caggggcctagcttctttcctcccctcttagctcttgccctcagcctaggctgggtccga
aggagccctcagagccgacgggactggggtctgtgtgcctctgcctctcccatcccacgc
tggcctggctgacccaggcagggcgtgctgaccaggcctgagccatggttccccccacag
AGATGCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGAGCTGCAGGGCGAGCTGCGGC
GGGAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTGAGGTGGAGCTGGAAT
ACTCCCGGGGCCTGGAAAAGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCCTGGGGA
GCAGCCGGGAGCACCAAAGCTTCCG
gtaggtgatgtgctggcaggggggccacggcagggcccaagctccgctcccaggtctcag
tgcccctctacccccaggaaggagccgtccctcctgtcgcccttgcactgctgggcggtg
ctgctgcagcacacgcggcagcagagccgggagagcgcggccctgagtgaggtgctggcc

Exon  4 +       5919       6081   2   Internal    163   100   Excellent
ctgaggtggagctggaatactcccggggcctggaaaagctggccgagcgcttctccagcc
gtggaggccgcctggggagcagccgggagcaccaaagcttccggtaggtgatgtgctggc
aggggggccacggcagggcccaagctccgctcccaggtctcagtgcccctctacccccag
GAAGGAGCCGTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCTGCTGCAGCACACGCG
GCAGCAGAGCCGGGAGAGCGCGGCCCTGAGTGAGGTGCTGGCCGGGCCCCTGGCCCAGCG
CCTGAGTCACATTGCAGAGGACGTGGGGCGCCTGGTCAAGAAG
gtgaggctctcatcctgggccacgggaagtgttcgaggctttgggatcaggaggcactgt
ggctgggagggcactggaggccaggtggggagcaggcagagcgaacctgtgtgccccccc
gatggggcttgatctgggcagagcttccagtgcctggcggggccgctctgggcagtgccg

Exon  5 +       6287       6349   0   Internal     63   100   Excellent
gaagtgttcgaggctttgggatcaggaggcactgtggctgggagggcactggaggccagg
tggggagcaggcagagcgaacctgtgtgcccccccgatggggcttgatctgggcagagct
tccagtgcctggcggggccgctctgggcagtgccgtgctcacccttgcctctgcctctag
AGCAGGGATCTGGAGCAGCAGCTGCAGGATGAGCTCCTGGAGGTGGTCTCAGAGCTCCAG
ACG
gtgaggaaagggctggggaggggcctgccccaatggtccagggagaaatgccactcacag
tggggaggaacaccgccagaccatcacatcaccccaagccaggctcagggagaagcacgc
acctaggggcaaaggcctctctccctaggcacagggcgttaggctaagtgctcacatggg

Exon  6 +       6637       6819   0   Internal    183    74        Good
gggagaagcacgcacctaggggcaaaggcctctctccctaggcacagggcgttaggctaa
gtgctcacatgggatcgcccagctctgaggtccaagttccagaggggcaggggtagaggg
ctgggggctggcccagccgtggccttcaccagcaccaccttgctttgggtctccctgcag
GCCAAGAAGACGTACCAGGCATATCACATGGAGAGCGTGAATGCCGAGGCCAAGCTCCGG
GAGGCCGAGCGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGT
GCCACTGAGGCAGGGCCCCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGCTGGTGGAG
AAG
gtgggcctggagggcacctcagacgcaggcctatgggccatgggccctaactaggacctg
ctgtgctgagggggaagtcagggctgggtgcaggggagggcaggagtggcaggacagtgc
catcaggttccagggattccatacggaaggctcccagggcctgagagagtggggaaaaca

Exon  7 +       8162       8290   0   Internal    129   100   Excellent
tggcactgggctgagcacactgtggactgtggcgtggggaaggcagcaggacttctgggc
ttgaccagttcaggtgtagttgtccacagtgggaggggaggcgatgggcattacatgaaa
ggctagagataggggctggccacgtgcgtgaccctggcacgcttgcattgtcttgagtag
CGGCAGGCCAAGTTCATGGAGCACAAACTCAAGTGCACAAAGGCGCGCAACGAGTACCTG
CTTAGCCTGGCTAGTGTCAACGCTGCTGTCAGTAACTACTACCTGCATGACGTCTTGGAC
CTCATGGAC
gtgagtccttggtgggcaggtgggaaaaggtgcctggtgcctcggggctgggaagctgtg
gctccaggacctacccaagcatctccttgtttcctcctcagtgctgtgacacagggttcc
acctggccctggggcaggtgctccggagctacacggccgctgagagccgcacccaagcct

Exon  8 +       8392       8613   0   Internal    222    98   Excellent
cgagtacctgcttagcctggctagtgtcaacgctgctgtcagtaactactacctgcatga
cgtcttggacctcatggacgtgagtccttggtgggcaggtgggaaaaggtgcctggtgcc
tcggggctgggaagctgtggctccaggacctacccaagcatctccttgtttcctcctcag
TGCTGTGACACAGGGTTCCACCTGGCCCTGGGGCAGGTGCTCCGGAGCTACACGGCCGCT
GAGAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTGTGGAG
GCCCTGGATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTGT
CCCCCGCTGCGCTTTGACTACCACCCCCATGATGGGGATGAG
gtgagggtcaccccctgctgggcttggcattctctggccttcactgtaatggtgggcagt
ggagtggcatgacccacactttgctcaggaatccaagttctccatggtctcaggcagtgc
ggcagctagagaagtgtcccacttccatttgcagcctcactccaagggtgcacccccgca

Exon  9 +      13566      13727   0   Internal    162    93   Excellent
acaagtcttggtttggacacgtgtgttcactcctgccattcttcagctgagcgtctgggc
tggtggtcctgtgcccggccgccaggccacaaaagggtgcttgcttcccttatgccccgg
ggatcttggcacctactgcccaagcccagcccttagccccctggccgccgccctctgcag
GTGGCTGAGATCTGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAAC
ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTCTGGGCAGCCCACCGG
GGGTTAGAGGGAGACGAGGGCCTGGAGCCTGTACAGCCTGCT
gttggaagtggctgccctgcctgcccccctccctttggccccttccttctgacttggact
tcctgtctccctccctgtcccccacctcttaccaccctggtgtggtctcctctgcaggtg
aacaagactctgaaggcgacactgcaggccctgctggaggtggtggcctcggatgacggg

Exon 10 +      13845      14036   0   Internal    192   100   Excellent
gaggtctgggcagcccaccgggggttagagggagacgagggcctggagcctgtacagcct
gctgttggaagtggctgccctgcctgcccccctccctttggccccttccttctgacttgg
acttcctgtctccctccctgtcccccacctcttaccaccctggtgtggtctcctctgcag
GTGAACAAGACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGTGGTGGCCTCGGATGAC
GGGGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGC
TCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACC
TTCTACCTCACG
gtggggagggctgggctggtgggcgggacccgtgggggcattgctggggcagagggaggg
gctcaagccagggctaacacttggggctcttcttggggctgcccagaagctccaggagta
tctgagtggacggagcatcctcgccaagctgcaggccaagcacgagaagctgcaggaggc

Exon 11 +      14143      14227   0   Internal     85    91   Excellent
gctcagacccaggcagccggcaggcgggccggaggcgcggccagcagcaggagaccgaaa
ccttctacctcacggtggggagggctgggctggtgggcgggacccgtgggggcattgctg
gggcagagggaggggctcaagccagggctaacacttggggctcttcttggggctgcccag
AAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAG
AAGCTGCAGGAGGCCCTTCAGCGAG
gtgggcccagtgctgcccccttccccgcctctcccctgcccaggaccctgtctagcccac
ggtcctcccctcccgcctgtccttggctcttatccacacctttctctctgggatgccttg
aagacccctggcccgagaggcagaccaatgttctcccaccccacaggtgacaaggaggag

Exon 12 +      14621      14835   1   Terminal    215    75        Good
tggggccctgcgacggtccgccatctcttctcttcctggggcccagctcagctgcccaat
cccctgggcctcacttccccagttttcgcactggattgtggaataacttcagagaattag
aggccggcttggctggcctggggggtggggcaccctattctccacacctggccccctcag
AGCCAGCTCCCATTCACTGCAGGACCCAGTACACACAGAGAAAATTCCAGAAGAGCCGCC
AGCCCCGCCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGGAGACATGGAGAAGTTTA
TCCAGGTACTAGCTTTGCCCCACATGCCAGCCCACCTGTACATGCTGATCTTTCTTCAGC
TCTGGGTCACCTCAGTGGCCGGAGCAGCTGCCTGA
tcccagggtcctccactctcaatcagtcatcaactgtccttttctgggtgggcctcttcc
aggccactgttgggctcccctatagcctccgctgattgaagggagcatccttaactagta
atgggaacgtatagaaaacctggggcagcggcatttttaggggcgagatattgagagctt

Exon 13 +      16256      16316   0   Internal     61    73        Good
aggagtatcacttgagcccaggaagctgaggctacagtgagccgagatcacgccagtgca
cttcagcctgggtgacagagtgagaccttgtctcaaaaaaaaaaaaaaaaaaaaaaagca
attgaatgacaacacagggcatgctgtgtccatggtgaagtaaacaccctctgtccccag
AGCTCAGGCCAGCCTGTGCCCCTGGTGGTGGAGAGCTGCATTCGCTTCATCAACCTCAAT
G
gtaagcaggacccagcccctcccgatgtcctggcacccagcacccagttcccagcacctg
gcatgggaggccatcctggaggggctggggaagatgctcagtgcccaccagctccttgtc
ctcccacaggcctgcagcatgaaggcatcttccgggtatcgggtgcccagctccgggtct

Exon 14 +      16341      16523   0    Initial    183    82        Good
ccttgtctcaaaaaaaaaaaaaaaaaaaaaaagcaattgaatgacaacacagggcatgct
gtgtccatggtgaagtaaacaccctctgtccccagagctcaggccagcctgtgcccctgg
tggtggagagctgcattcgcttcatcaacctcaatggtaagcaggacccagcccctcccg
ATGTCCTGGCACCCAGCACCCAGTTCCCAGCACCTGGCATGGGAGGCCATCCTGGAGGGG
CTGGGGAAGATGCTCAGTGCCCACCAGCTCCTTGTCCTCCCACAGGCCTGCAGCATGAAG
GCATCTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCCTTCGAGA
GAG
gtggggacgggcagggcgggcgggggtgggggctcgggcagatgtcaccagcttcctccc
cctaccgcaccactcgcccatctgcaggggaggacccactggtggagggctgcactgccc
atgacctggactcggtggccggggtgctgaagctctacttccggagcctggagcccccac

Exon 15 +      16611      16745   1   Internal    135   100   Excellent
cttgtcctcccacaggcctgcagcatgaaggcatcttccgggtatcgggtgcccagctcc
gggtctcagagatccgtgatgccttcgagagaggtggggacgggcagggcgggcgggggt
gggggctcgggcagatgtcaccagcttcctccccctaccgcaccactcgcccatctgcag
GGGAGGACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGTGGCCGGGGTGC
TGAAGCTCTACTTCCGGAGCCTGGAGCCCCCACTCTTCCCCCCAGACCTGTTCGGCGAGC
TGCTGGCTTCTTCGG
gtgaggctggggcctgaggctggcggggtagggcacttgctggggcagccccgctcacgc
ggctctctctgggcggctttggccacagagctggaggccacagcggagagggtggagcac
gtgagccgcctgctgtggcggctgcccgcgccggtgctggtggttctgcgctacctcttc

Exon 16 +      16834      16939   1   Internal    106   100   Excellent
ctcggtggccggggtgctgaagctctacttccggagcctggagcccccactcttcccccc
agacctgttcggcgagctgctggcttcttcgggtgaggctggggcctgaggctggcgggg
tagggcacttgctggggcagccccgctcacgcggctctctctgggcggctttggccacag
AGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGTGGCGGCTGCCCG
CGCCGGTGCTGGTGGTTCTGCGCTACCTCTTCACCTTCCTCAACCA
gtgagtgctgcggggcgagtgctggggtgggggccaggggtcgaggggacagggggactc
ggggtgcgggctctctgcttgtgatgtgcgtgtccccccagcctggcccagtacagcgat
gagaacatgatggacccctacaacctggccgtgtgcttcgggcccacgctgctaccggtg

Exon 17 +      17041      17241   2   Internal    201    85        Good
agcacgtgagccgcctgctgtggcggctgcccgcgccggtgctggtggttctgcgctacc
tcttcaccttcctcaaccagtgagtgctgcggggcgagtgctggggtgggggccaggggt
cgaggggacagggggactcggggtgcgggctctctgcttgtgatgtgcgtgtccccccag
CCTGGCCCAGTACAGCGATGAGAACATGATGGACCCCTACAACCTGGCCGTGTGCTTCGG
GCCCACGCTGCTACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAA
CCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCCCCTGACCTCGCT
GCCTGGCCCCGTCTACGAGAA
gtgcatggcaccgccttccgccagctgcctggggtacacccttggtgctgccgaggggac
tggggggtccactggagaagagcccccctcatctgcctcgctctgccctgaacctcaggg
acgcccagctggagagcctgggggcggacaatgagccggagctggaagccgagatgcccg

Exon 18 +      17360      17433   2   Internal     74   100   Excellent
atagtgcagcccgatcgggtcttcccgcccctgacctcgctgcctggccccgtctacgag
aagtgcatggcaccgccttccgccagctgcctggggtacacccttggtgctgccgagggg
actggggggtccactggagaagagcccccctcatctgcctcgctctgccctgaacctcag
GGACGCCCAGCTGGAGAGCCTGGGGGCGGACAATGAGCCGGAGCTGGAAGCCGAGATGCC
CGCACAGGAGGATG
gtgagggcgatgggcagagagccccaccctgtccccaccctagtgtccacaccccctccc
acagcttggaccccctctcctccccagacctggagggggtcgtggaggctgtggcctgct
ttgcctacacgggccgcacagcccaggagctgagcttccggcggggggacgtactgcggc

Exon 19 +      17498      17704   2   Internal    207   100   Excellent
gaagagcccccctcatctgcctcgctctgccctgaacctcagggacgcccagctggagag
cctgggggcggacaatgagccggagctggaagccgagatgcccgcacaggaggatggtga
gggcgatgggcagagagccccaccctgtccccaccctagtgtccacaccccctcccacag
CTTGGACCCCCTCTCCTCCCCAGACCTGGAGGGGGTCGTGGAGGCTGTGGCCTGCTTTGC
CTACACGGGCCGCACAGCCCAGGAGCTGAGCTTCCGGCGGGGGGACGTACTGCGGCTGCA
CGAGAGGGCCTCGAGCGACTGGTGGCGGGGGGAGCACAACGGCATGCGGGGCCTCATCCC
CCACAAGTATATCACGCTGCCCGCCGG
gtgagtgagccgcgccctcaggccccagggctcccggagtctccccttcatccacccctc
ccccgaccccaagttagattctgaaggtctgggctgggccagagaacagagcctctctga
ccactcctggctggcgcggagctgctggccctggaccccgtgcagggaaggagcactcga

Exon 20 +      17910      18002   2   Internal     93    80        Good
cagggctcccggagtctccccttcatccacccctcccccgaccccaagttagattctgaa
ggtctgggctgggccagagaacagagcctctctgaccactcctggctggcgcggagctgc
tggccctggaccccgtgcagggaaggagcactcgaaacaggccggtccttcccaccgcag
GACGGAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTCTGGGAGCAGTCC
CGAGGGCCTCCTGGCATCGGAGCTGGTCCACCG
gtgagcaagaagacggggctcagggggccacacgtgtgctgttctaggccagaggggact
ggggtcaggctttggccagtgggagtgggaggagttggcagatgaggacgtgacagaatg
acccagcttgtgacagggagaggctctagaggagcttggggaccactgggccagcctcct

Exon 21 +      18276      18375   2   Internal    100    75        Good
gttggcagatgaggacgtgacagaatgacccagcttgtgacagggagaggctctagagga
gcttggggaccactgggccagcctcctttccttggccacaccccaggatgggaggagcca
ctgcccagctagctcagggacttcccagggcccccaccaggctccctgtctgtcctgcag
GCCAGAGCCATGCACCTCACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTT
GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAG
gtgagagtgggtgtgtggcaggtgagggacatctgtcctgggggatctctgcctcccctt
ggaagccaaactcctccctcctcgaggttccagtcgttgccctccctggccttagctcaa
gggaacctgccgccagacacacaggcccaaggcagagcctgtggagggcaggaaggcaaa

Exon 22 +      18946      19042   0    Initial     97    47    Marginal
catggcaggcgcttggcacgccagggaggatgaaagggacagatggcagggaggcaggag
ggggtggctggttggggattggggtggggcagcagcggctctcgaaggagcagagcgaag
gctcaagatgtggccctggcaagcgcacaacctgggggaccctgctccgtgctctgtacc
ATGGGCCCTGTGAACACTGTCGGGCTGAACGTGGAAGCCCGCGGGACAGTTGCTAAGCCC
AAGGAGGAGAGAGCCCAAGAACATGCGGGTGTCCCAG
gtgtggccaagcccccaggcccagggagcccagggagggtccggtagacacggaggagca
ggagcgggagccagggacagggcagccaggagacgccatgggaggacattgactggggag
tccccgcacgctggcggtccctgaggccatgggcagggggctgtgatctctgccagggaa

Exon 23 +      20741      20861   2   Terminal    121    70        Good
gctgtggcttgtccagggccacacagtgtcccagcctcggggccacaggctctggccaat
tctccacgggtccccctcccagtggctcccaggaccagccccaggaaggcagctgagctt
ctcaaagcctctagaggcaagacacccaacagctcctcacgatgaagtgtccttggccag
GGAGGAGCTGGCGGTGGTGCAGGACTCATCTTGGGGACCCAGGCTGGGTGGGGTGCGTCC
CCGGGCACAGCAGAGCAAGCTTCGCAGCTCTGAGGACACGCTGCTGCTGAAAGATGCATA
G
atccaggggttggtgcagctgttgaggctggccagcaacatgagtagcacaaagggcgcc
cctgtggaggtggaggatctaggttgggttcaggatggctggtggggcacaggggcatgc
ggccaagcccaagtggccccgtcagccctagccacggctacacccaccttccagaggtgc

--------------------------------------------------------------------------------